Transcript asmbl_44726

Sequence
Transcript Sequence for observation asmbl_44726 of TGE0056205:
GGGAGGGGGCAGCGCCAACAAATTGGGGAGCTCGGCCCGCCGCGCTCAGGTCTCCGCTTGGAGCCGCCGCACCCGGGACGGTGCGTAGCGCTGGAAGTCCGGCCTTCCGAGAGCTAGCTGTCCGCCGCGGCCCCCGCACGCCGGGCAGCCGTCCCTCGCCGCCTCGGGCGCGCCACCATGGGGCCCCGGCTCAGCGTCTGGCTGCTGCTGCTGCCCGCCGCCCTTCTGCTCCACGAGGAGCACAGCCGGGCCGCTGCGAAGGGTGGCTGTGCTGGCTCTGGCTGTGGCAAATGTGACTGCCATGGAGTGAAGGGACAAAAGGGTGAAAGAGGCCTCCCGGGGTTACAAGGTGTCATTGGGTTTCCTGGAATGCAAGGACCTGAGGGGCCACAGGGACCACCAGGACAAAAGGGTGATACTGGAGAACCAGGACTACCTGGAACAAAAGGGACAAGAGGACCTCCGGGAGCATCTGGCTACCCTGGAAACCCAGGACTTCCCGGAATTCCTGGCCAAGACGGCCCGCCAGGCCCCCCAGGTATTCCAGGATGCAATGGCACAAAGGGGGAGAGAGGGCCGCTCGGGCCTCCTGGCTTGCCTGGTTTCGCTGGAAATCCCGGACCACCAGGCTTACCAGGGATGAAGGGTGATCCAGGTGAGATACTTGGCCATGTGCCCGGGATGCTGTTGAAAGGTGAAAGAGGATTTCCCGGAATCCCAGGGACTCCAGGCCCACCAGGACTGCCAGGGCTTCAAGGTCCTGTTGGGCCTCCAGGATTTACCGGACCACCAGGTCCCCCAGGCCCTCCCGGCCCTCCAGGTGAAAAGGGACAAATGGGCTTAAGTTTTCAAGGACCAAAAGGTGACAAGGGTGACCAAGGGGTCAGTGGGCCTCCAGGAGTACCAGGACAAGCTCAAGTTCAAGAAAAAGGAGACTTCGCCACCAAGGGAGAAAAGGGCCAAAAAGGTGAACCTGGATTTCAGGGGATGCCAGGGGTCGGAGAGAAAGGTGAACCCGGAAAACCAGGACCCAGAGGCAAACCCGGAAAAGATGGTGACAAAGGGGAAAAAGGGAGTCCCGGTTTTCCTGGTGAACCCGGGTACCCAGGACTCATAGGCCGCCAGGGCCCGCAGGGAGAAAAGGGTGAAGCAGGTCCTCCTGGCCCACCTGGAATTGTTATAGGCACAGGACCTTTGGGAGAAAAAGGAGAGAGGGGCTACCCTGGAACTCCGGGGCCAAGAGGAGAGCCAGGCCCAAAAGGTTTCCCAGGACTACCAGGCCAACCCGGACCTCCAGGCCTCCCTGTACCTGGGCAGGCTGGTGCCCCTGGCTTCCCTGGTGAAAGAGGAGAAAAAGGTGACCGAGGATTTCCTGGTACATCTCTGCCAGGACCAAGTGGAAGAGATGGGCTCCCGGGTCCTCCTGGTTCCCCTGGGCCCCCTGGGCAGCCTGGCTACACAAATGGAATTGTGGAATGTCAGCCCGGACCTCCAGGTGACCAGGGTCCTCCTGGAATTCCAGGGCAGCCAGGATTTATAGGCGAAATTGGAGAGAAAGGTCAAAAAGGAGAGAGTTGCCTCATCTGTGATATAGACGGATATCGGGGGCCTCCCGGGCCACAGGGACCCCCGGGAGAAATAGGTTTCCCAGGGCAGCCAGGGGCCAAGGGCGACAGAGGTTTGCCTGGCAGAGATGGTGTTGCAGGAGTGCCAGGCCCTCAAGGTACACCAGGGCTGATAGGCCAGCCAGGAGCCAAGGGGGAGCCTGGTGAGTTTTATTTCGACTTGCGGCTCAAAGGTGACAAAGGAGACCCAGGCTTTCCAGGACAGCCCGGCATGCCAGGGAGAGCGGGTTCTCCTGGAAGAGATGGCCATCCGGGTCTTCCTGGCCCCAAGGGCTCGCCGGGTTCTGTAGGATTGAAAGGAGAGCGTGGCCCCCCTGGAGGAGTTGGATTCCCAGGCAGTCGTGGTGACACCGGCCCCCCTGGGCCTCCAGGATATGGTCCTGCTGGTCCCATTGGTGACAAAGGACAAGCAGGCTTTCCTGGAGGCCCTGGATCCCCAGGCCTGCCAGGTCCAAAGGGTGAACCAGGAAAAATTGTTCCTTTACCAGGCCCCCCTGGAGCAGAAGGACTGCCGGGGTCCCCAGGCTTCCCAGGTCCCCAAGGAGACCGAGGCTTTCCCGGAACCCCAGGAAGGCCAGGCCTGCCAGGAGAGAAGGGCGCTGTGGGCCAGCCAGGCATTGGATTTCCAGGGCCCCCCGGCCCCAAAGGTGTTGACGGCTTACCTGGAGACATGGGGCCACCGGGGACTCCAGGTCGCCCGGGATTTAATGGCTTACCTGGGAACCCAGGTGTGCAGGGCCAGAAGGGAGAGCCTGGAGTTGGTCTACCGGGACTCAAAGGTTTGCCAGGTCTTCCCGGCATTCCTGGCACACCCGGGGAGAAGGGGAGCATTGGGGTACCAGGCGTTCCTGGAGAACATGGAGCGATCGGACCCCCTGGGCTTCAGGGGATCAGAGGTGAACCGGGACCTCCTGGATTGCCAGGCTCCGTGGGGTCTCCAGGAGTTCCAGGAATAGGCCCCCCTGGAGCTAGGGGTCCCCCTGGAGGACAGGGACCACCGGGGTTGTCAGGCCCTCCTGGAATAAAAGGAGAGAAGGGTTTCCCCGGATTCCCTGGACTGGACATGCCGGGCCCTAAAGGAGATAAAGGGGCTCAAGGACTCCCTGGCATAACGGGACAGTCGGGGCTCCCTGGCCTTCCTGGACAGCAGGGGGCTCCTGGGATTCCTGGGTTTCCAGGTTCCAAGGGAGAAATGGGCGTCATGGGGACCCCCGGGCAGCCGGGCTCACCAGGACCAGTGGGTGCTCCTGGATTACCGGGTGAAAAAGGGGACCATGGCTTTCCGGGCTCCTCAGGACCCAGGGGAGACCCTGGCTTGAAAGGTGATAAGGGGGATGTCGGTCTCCCTGGCAAGCCTGGCTCCATGGATAAGGTGGACATGGGCAGCATGAAGGGCCAGAAAGGAGACCAAGGAGAGAAAGGACAAATTGGACCAATTGGTGAGAAGGGATCCCGAGGAGACCCTGGGACCCCAGGAGTGCCTGGAAAGGACGGGCAGGCAGGACAGCCTGGGCAGCCAGGACCTAAAGGTGATCCAGGTATAAGTGGAACCCCAGGTGCTCCAGGACTTCCGGGACCAAAAGGATCTGTTGGTGGAATGGGCTTGCCAGGAACACCTGGAGAGAAAGGTGTGCCTGGCATCCCTGGCCCACAAGGTTCACCTGGCTTACCTGGAGACAAAGGTGCAAAAGGAGAGAAAGGGCAGGCAGGCCCACCTGGCATAGGCATCCCAGGGCTGCGAGGTGAAAAGGGAGATCAAGGGATAGCGGGTTTCCCAGGAAGCCCTGGAGAGAAGGGAGAAAAAGGAAGCATTGGGATCCCAGGAATGCCAGGGTCCCCAGGCCTTAAAGGGTCTCCCGGGAGTGTTGGCTATCCAGGAAGTCCTGGGCTACCTGGAGAAAAAGGTGACAAAGGCCTCCCAGGATTGGATGGCATCCCTGGTGTCAAAGGAGAAGCAGGTCTTCCTGGGACTCCTGGCCCCACAGGCCCAGCTGGCCAGAAAGGGGAGCCAGGCAGTGATGGAATCCCGGGGTCAGCAGGAGAGAAGGGTGAACCAGGTCTACCAGGAAGAGGATTCCCAGGGTTTCCAGGGGCCAAAGGAGACAAAGGTTCAAAGGGTGAGGTGGGTTTCCCAGGATTAGCCGGGAGCCCAGGAATTCCTGGATCCAAAGGAGAGCAAGGATTCATGGGTCCTCCGGGGCCCCAGGGACAGCCGGGGTTACCGGGATCCCCAGGCCATGCCACGGAGGGGCCCAAAGGAGACCGCGGACCTCAGGGCCAGCCTGGCCTGCCAGGACTTCCGGGACCCATGGGGCCTCCAGGGCTTCCTGGGATTGATGGAGTTAAAGGTGACAAAGGAAATCCAGGCTGGCCAGGAGCACCCGGTGTCCCAGGGCCCAAGGGAGACCCTGGATTCCAGGGCATGCCTGGTATTGGTGGCTCTCCAGGAATCACAGGCTCTAAGGGTGATATGGGGCCTCCAGGAGTTCCAGGATTTCAAGGTCCAAAAGGTCTTCCTGGCCTCCAGGGAATTAAAGGTGATCAAGGCGATCAAGGCGTCCCGGGAGCTAAAGGTCTCCCGGGTCCTCCTGGCCCCCCAGGTCCTTACGACATCATCAAAGGGGAGCCCGGGCTCCCTGGTCCTGAGGGCCCCCCAGGGCTGAAAGGGCTTCAGGGACTGCCAGGCCCGAAAGGCCAGCAAGGTGTTACAGGATTGGTGGGTATACCTGGACCTCCAGGTATTCCTGGGTTTGACGGTGCCCCTGGCCAGAAAGGAGAGATGGGACCTGCCGGGCCTACTGGTCCAAGAGGATTTCCAGGTCCACCAGGCCCCGATGGGTTGCCAGGATCCATGGGGCCCCCAGGCACCCCATCTGTTGATCACGGCTTCCTTGTGACCAGGCATAGTCAAACAATAGATGACCCACAGTGTCCTTCTGGGACCAAAATTCTTTACCACGGGTACTCTTTGCTCTACGTGCAAGGCAATGAACGGGCCCATGGCCAGGACTTGGGCACGGCCGGCAGCTGCCTGCGCAAGTTCAGCACAATGCCCTTCCTGTTCTGCAATATTAACAACGTGTGCAACTTTGCATCACGAAATGACTACTCGTACTGGCTGTCCACCCCTGAGCCCATGCCCATGTCAATGGCACCCATCACGGGGGAAAACATAAGACCATTTATTAGTAGGTGTGCTGTGTGTGAGGCGCCTGCCATGGTGATGGCCGTGCACAGCCAGACCATTCAGATCCCACCGTGCCCCAGCGGGTGGTCCTCGCTGTGGATCGGCTACTCTTTTGTGATGCACACCAGCGCTGGTGCAGAAGGCTCTGGCCAAGCCCTGGCGTCCCCCGGCTCCTGCCTGGAGGAGTTTAGAAGTGCGCCATTCATCGAGTGTCACGGCCGTGGGACCTGCAATTACTACGCAAACGCTTACAGCTTTTGGCTCGCCACCATAGAGAGGAGCGAGATGTTCAAGAAGCCTACGCCGTCCACCTTGAAGGCAGGGGAGCTGCGCACGCACGTCAGCCGCTGCCAAGTCTGTATGAGAAGAACATAATGAAGCCTGACTCAGCTAATGTCACAACATGGTGCTACTTCTTCTTCTTTTTGTTAACAGCAACGAACCCTAGAAATATATCCTGTGTACCTCACTGTCCAATATGAAAACCGTAAAGTGCCTTATAGGAATTTGCGTAACTAACACACCCTGCTTCATTGACCTCTACTTGCTGAAGGAGAAAAAGACAGCGATAAGCTTTCAATAGTGGCATACCAAATGGCACTTTTGATGAAATAAAATATCAATATTTTCTGCAATCCAATGCACTGATGTGTGAAGTGAGAACTCCATCAGAAAACCAAAGGGTGCTAGGAGGTGTGGGTGCCTTCCATACTGTTTGCCCATTTTCATTCTTGTATTATAATTAATTTTCTACCCCCAGAGATAAATGTTTGTTTATATCACTGTCTAGCTGTTTCAAAATTTAGGTCCCTTGGTCTGTACAAATAATAGCAATGTAAAAATGGTTTTTTGAACCTCCAAATGGAATTACAGACTCAGTAGCCATATCTTCCAACCCCCCAGTATAAATTTCTGTCTTTCTGCTATGTGTGGTACTTTGCAGCTGCTTTTGCAGAAATCACAATTTTCCTGTGGAATAAAGATGGTCCAAAAATAGTCAAAAATTAAATATATATATATATTAGTAATTTATATAGATGTCAGCAATTAGGCAGATCAAGGTTTAGTTTAACTTCCACTGTTAAAATAAAGCTTACATAGTTTTCTTCCTTTGAAAGACTGTGCTGTCCTTTAACATAGGTTTTTAAAGACTAGGATATTGAATGTGAAACATCCGTTTTCATTGTTCACTTCTAAACCAAAAATTATGTGTTGCCAAAACCAAACCCAGGTTCATGAATATGGTGTCTATTATAGTGAAACATGTACTTTGAGCTTATTGTTTTTATTCTGTATTAAATATTTTCAGGGTTTTAAACACTAATCACAAACTGAATGACTTGACTTCAAAAGCAACAACCTTAAAGGCCGTCATTTCATTAGTATTCCTCATTCTGCATCCTGGCTTGAAAAACAGCTCTGTTGAATCACAGTATCAGTATTTTCACACGTAAGCACATTCGGGCCATTTCCGTGGTTTCTCATGAGCTGTGTTCACAGACCTCAGCAGGGCATCGCATGGACCGCAGGAGGGCAGATTCGGACCACTAGGCCTGAAATGACATTTCACTAAAAGTCTCCAAAACATTTCTAAGACTACTAAGGCCTTTTATGTAATTTCTTTAAATGTGTATTTCTTAAGAATTCAAATTTGTAATAAAACTATTTGTATAAAAATTAAGCTTTTATTAATTTGTTGCTAGTATTGCCACAGACGCATTAAAAGAAACTTACTGCACAAGCTGCTAATAAATTTGTAAGCTTTGCATACCTTAGATTATTTTTATTTTGCACTTCTTCCAAATGAGAGTCACAGACTGGGGGTGATTTATAGTGACTACAACAA