Transcript asmbl_44725

Sequence
Transcript Sequence for observation asmbl_44725 of TGE0058653:
AATCTTTGCTCACTGTGCTCTTCCTTTTCAACCAACCGCTGCTGCCTGATTAGCAGAACAAGGGGCAGTGTCTTCAGGATGAAGCCCCATGCCTGTTGGCCAGGCAGCAACGGGATGGAGGATGGGTGCTGAGCCCAGAGGGCAATGCCTGCAAGACACATGTGGTTCCCTTCTAATTAATGGATCAAAATGGCGTGCAGTACACTCATGATCAGAATTATCTTTTACTTGGACTAATTTTGTAAAAATCCAGCAGAGAGGCGAGACCCCTGTCATTTTTATGCCTAGAAGGTCATCAGAATATTGAAATTCTGACTTTCTAGAACTGGTTATACTTATGTGAATGCAGGACAGTATGTAGCACACACCACGAGACAAAAACATGCCCTGCGCAGCCACGATGTGCTCAGTACTAAGTGCAGCTGAGAGTTGGCCAGGAGCTTGGGAAGGCAGTCTCTTCTCTCAGAGAGCTGAGCATTTCATGGGAAAGCAAAGGGGACACAGAAAATACAAGGCATGTGAGCTGCACGACACTGAAGAGAAGCCACAGGTGGCCGCAGCCAGGAGCTCACACACAGCATCCATGGGCATGCTTATGGCCCGTGGCTGGGCTGGCTGAGTGATCCCACTCAGTGGGAGGATTCAGAAAGCCCTGGAAGGCCTTGGACTTCAGCTGAGAAGGAGCAGGGGCACGGAGGTGTTGTTTCTCCCACCCCCTGGTTCTCCCCGAGACCAGCCCAGAGTGTTTCCTTGGCAGGCATGTAGTCTGACACTGGGAACCCCTGGGTTGAGAAGGATGGCCTGGTGCCGGGTGGGCTGCCTTGGGAATGGACACTTCCCTCTCCCTTAACTCACAGAATCCCTCAAACACAGAGCCCCTTGCAAATGCACCTGCTCAAGGGGTCGCTGTGGGCTGTTCCTGCCCTGCCTTTCCTACCTTGCCATGTGATCCCGCACACTCCTTTGGACATGCTGCACTGCCCTTGCACAAACTCTACGCAGCACCTTGCGTTTTCCACTCATTGCTGTGTGAAATAGCAGGGAGAATCCCCAGGAGAAGAGAATCCCAAATGACCACTTTAGGTCTTGACCCTATTTCATTCCCTTTTCCTTTGTTTTGGAAATAACCTTAGAATTTTGGCATTTTTATTGGTAAGATTTGGATACTATGTTTAAAACTAAACATAGAATTTCTTTTTCCTACAAGCTGTTACTTTTTAATTTTTTAAACCTGCTCTATTGAAGTTTCACTGACAGGTCATAAACTACAAATATTTAAAGTGGACAATTTGATAAGGCTGACATAGGTCTACACCATGAAAACATCCCCACATTCTAGATAGCAGGCAAAGCCTTCCCCCAAAAGTCTCCTCCGTGGCTTCATAATCCCCCCCTCCTGCCCTCTCCCCATTCCCCAAGCAACCGTCCATCTGCCTTCTGGTCCTCTAGGTTAGTTTGCATTTTCCAGCAGTTTACAAAAATAAAACCATACACTTCGTAGTCTTTTCAGCCTGACTACTCTCCCACGACATAATTCGTTTGAGATCCAGCCCAGTGGTTGCTCACTTCTTTCTATGGCTGAGTAGTGTCCCACTGCATGGATATAACATGATTGGCTTGTCCAGCCCATTCATGTGCTGATGGAGTGAGGCTTTCGTTTAGCAGTGCAGTTGCTGCAGATGTCTTTAAACACAATTCAGATGCCTTTGCCATAGAACACGTCTCGTGAGAAGTATGAAAACGATAGCTGGGTTCCTAGCATTCTGAGCTCTTTTTCCAGCCAGGCCATGGTCGGATTCTAGTGTGTTATTAAAGAGAAGGAGGGATCGGAGCCCTTGCTGCAGTTTCCTGTGGTGTCCCTGGAAGCTCCCTCTGAGCGGTACCTACAGGATGAGGCACGCCTCATCCCATCTCTGCCGTCCACGCTGGAGATTACTGTTCTGCTGCTGCGTTTCCCATCACCTCAAACTGTTTTTCTTGTTCAGGTTCAAAGGGTGAGGTGGGTTTCCCAGGATTAGCCGGGAGCCCAGGAATTCCTGGATCCAAAGGAGAGCAAGGATTCATGGGTCCTCCGGGGCCCCAGGGACAGCCGGGGTTACCGGGATCCCCAGGCCATGCCACGGAGGGGCCCAAAGGAGACCGCGGACCTCAGGGCCAGCCTGGCCTGCCAGGACTTCCGGGACCCATGGGGCCTCCAGGGCTTCCTGGGATTGATGGAGTTAAAGGTGACAAAGGAAATCCAGGCTGGCCAGGAGCACCCGGTGTCCCAGGGCCCAAGGGAGACCCTGGATTCCAGGGCATGCCTGGTATTGGTGGCTCTCCAGGAATCACAGGCTCTAAGGGTGATATGGGGCCTCCAGGAGTTCCAGGATTTCAAGGTCCAAAAGGTCTTCCTGGCCTCCAGGGAATTAAAGGTGATCAAGGCGATCAAGGCGTCCCGGGAGCTAAAGGTCTCCCGGGTCCTCCTGGCCCCCCAGGTCCTTACGACATCATCAAAGGGGAGCCCGGGCTCCCTGGTCCTGAGGGCCCCCCAGGGCTGAAAGGGCTTCAGGGACTGCCAGGCCCGAAAGGCCAGCAAGGTGTTACAGGATTGGTGGGTATACCTGGACCTCCAGGTATTCCTGGGTTTGACGGTGCCCCTGGCCAGAAAGGAGAGATGGGACCTGCCGGGCCTACTGGTCCAAGAGGATTTCCAGGTCCACCAGGCCCCGATGGGTTGCCAGGATCCATGGGGCCCCCAGGCACCCCATCTGTTGATCACGGCTTCCTTGTGACCAGGCATAGTCAAACAATAGATGACCCACAGTGTCCTTCTGGGACCAAAATTCTTTACCACGGGTACTCTTTGCTCTACGTGCAAGGCAATGAACGGGCCCATGGCCAGGACTTGGGCACGGCCGGCAGCTGCCTGCGCAAGTTCAGCACAATGCCCTTCCTGTTCTGCAATATTAACAACGTGTGCAACTTTGCATCACGAAATGACTACTCGTACTGGCTGTCCACCCCTGAGCCCATGCCCATGTCAATGGCACCCATCACGGGGGAAAACATAAGACCATTTATTAGTAGGTGTGCTGTGTGTGAGGCGCCTGCCATGGTGATGGCCGTGCACAGCCAGACCATTCAGATCCCACCGTGCCCCAGCGGGTGGTCCTCGCTGTGGATCGGCTACTCTTTTGTGATGCACACCAGCGCTGGTGCAGAAGGCTCTGGCCAAGCCCTGGCGTCCCCCGGCTCCTGCCTGGAGGAGTTTAGAAGTGCGCCATTCATCGAGTGTCACGGCCGTGGGACCTGCAATTACTACGCAAACGCTTACAGCTTTTGGCTCGCCACCATAGAGAGGAGCGAGATGTTCAAGAAGCCTACGCCGTCCACCTTGAAGGCAGGGGAGCTGCGCACGCACGTCAGCCGCTGCCAAGTCTGTATGAGAAGAACATAATGAAGCCTGACTCAGCTAATGTCACAACATGGTGCTACTTCTTCTTCTTTTTGTTAACAGCAACGAACCCTAGAAATATATCCTGTGTACCTCACTGTCCAATATGAAAACCGTAAAGTGCCTTATAGGAATTTGCGTAACTAACACACCCTGCTTCATTGACCTCTACTTGCTGAAGGAGAAAAAGACAGCGATAAGCTTTCAATAGTGGCATACCAAATGGCACTTTTGATGAAATAAAATATCAATATTTTCTGCAATCCAATGCACTGATGTGTGAAGTGAGAACTCCATCAGAAAACCAAAGGGTGCTAGGAGGTGTGGGTGCCTTCCATACTGTTTGCCCATTTTCATTCTTGTATTATAATTAATTTTCTACCCCCAGAGATAAATGTTTGTTTATATCACTGTCTAGCTGTTTCAAAATTTAGGTCCCTTGGTCTGTACAAATAATAGCAATGTAAAAATGGTTTTTTGAACCTCCAAATGGAATTACAGACTCAGTAGCCATATCTTCCAACCCCCCAGTATAAATTTCTGTCTTTCTGCTATGTGTGGTACTTTGCAGCTGCTTTTGCAGAAATCACAATTTTCCTGTGGAATAAAGATGGTCCAAAAATAGTCAAAAATTAAATATATATATATATTAGTAATTTATATAGATGTCAGCAATTAGGCAGATCAAGGTTTAGTTTAACTTCCACTGTTAAAATAAAGCTTACATAGTTTTCTTCCTTTGAAAGACTGTGCTGTCCTTTAACATAGGTTTTTAAAGACTAGGATATTGAATGTGAAACATCCGTTTTCATTGTTCACTTCTAAACCAAAAATTATGTGTTGCCAAAACCAAACCCAGGTTCATGAATATGGTGTCTATTATAGTGAAACATGTACTTTGAGCTTATTGTTTTTATTCTGTATTAAATATTTTCAGGGTTTTAAACACTAATCACAAACTGAATGACTTGACTTCAAAAGCAACAACCTTAAAGGCCGTCATTTCATTAGTATTCCTCATTCTGCATCCTGGCTTGAAAAACAGCTCTGTTGAATCACAGTATCAGTATTTTCACACGTAAGCACATTCGGGCCATTTCCGTGGTTTCTCATGAGCTGTGTTCACAGACCTCAGCAGGGCATCGCATGGACCGCAGGAGGGCAGATTCGGACCACTAGGCCTGAAATGACATTTCACTAAAAGTCTCCAAAACATTTCTAAGACTACTAAGGCCTTTTATGTAATTTCTTTAAATGTGTATTTCTTAAGAATTCAAATTTGTAATAAAACTATTTGTATAAAAATTAAGCTTTTATTAATTTGTTGCTAGTATTGCCACAGACGCATTAAAAGAAACTTACTGCACAAGCTGCTAATAAATTTGTAAGCTTTGCATACCTTAGATTATTTTTATTTTGCACTTCTTCCAAATGAGAGTCACAGACTGGGGGTGATTTATAGTGACTACAACAA