Transcript asmbl_44724

Sequence
Transcript Sequence for observation asmbl_44724 of TGE0058652:
AGACTCTGTCTCAAAAAAAAAAGAGGAAGAAAAAGAAATACACCCCATTCCTGGTGCCAGTCAGTGTCTGTCTGTCTCTGTATACATACTTATGTATAAATATGTGTTTGTATATATGTTTATATACATATATATTTGTTCATGTTATTTTGGTTTGACACTTTTAAAATAAGGCTAAGAAACAAATCTACGTAAGAAATAAAACAACTTGTTACATGTTGCTGTCCACGACTTGAGAAAGGAACGACTTGTTGAAATGGAAAGAAAATGAGCCCCTATTTTAAAATACACGAATATTGCCACAGTATAAAGGAAAATACTCGTTCCTTAGCATTTCTTAATTTTCTTTGCATATTTAAAATCAGTTTTCAGATAAGACATGAAACTAATTCTAAAGAAAACTGATTGCACTTGAGGATTAAGGGGAAAGTTTTCAGAAAAGCTCGTTGGCTGGTGCTGGATGGCTATGTTGCCGTCACAGGTGTTGAGGGGGCCCTGGCTCTGTCTATGGCATCGTGCTGTGAGCTGGAGGTGGCAAGGGCAGGACATTTGCCTGCTCCTCAGGCGCTTCCCCTGTGGATGGACAAGCAGAGGAGATACATGGGAGGGAAACAAATGCTTCTACTTTCCAGCTTCCCGATTGAGGCACATGCAAAGGTGTTGTTATTCTGTCATTTAAGAAACCACAAGGCACCATTTGTTCACAAATGTGCTTTCCAGAACATTGAGGGGCTGTTTCCATTTTCCAACTAGCAGGTTACTGGAGAGACTTAACCTACATATCCTGAGCAATTCCCAACCTCCTCTTTGCGTGTCTAGGGTATTGGTGGCTCTCCAGGAATCACAGGCTCTAAGGGTGATATGGGGCCTCCAGGAGTTCCAGGATTTCAAGGTCCAAAAGGTCTTCCTGGCCTCCAGGGAATTAAAGGTGATCAAGGCGATCAAGGCGTCCCGGGAGCTAAAGGTCTCCCGGGTCCTCCTGGCCCCCCAGGTCCTTACGACATCATCAAAGGGGAGCCCGGGCTCCCTGGTCCTGAGGGCCCCCCAGGGCTGAAAGGGCTTCAGGGACTGCCAGGCCCGAAAGGCCAGCAAGGTGTTACAGGATTGGTGGGTATACCTGGACCTCCAGGTATTCCTGGGTTTGACGGTGCCCCTGGCCAGAAAGGAGAGATGGGACCTGCCGGGCCTACTGGTCCAAGAGGATTTCCAGGTCCACCAGGCCCCGATGGGTTGCCAGGATCCATGGGGCCCCCAGGCACCCCATCTGTTGATCACGGCTTCCTTGTGACCAGGCATAGTCAAACAATAGATGACCCACAGTGTCCTTCTGGGACCAAAATTCTTTACCACGGGTACTCTTTGCTCTACGTGCAAGGCAATGAACGGGCCCATGGCCAGGACTTGGGCACGGCCGGCAGCTGCCTGCGCAAGTTCAGCACAATGCCCTTCCTGTTCTGCAATATTAACAACGTGTGCAACTTTGCATCACGAAATGACTACTCGTACTGGCTGTCCACCCCTGAGCCCATGCCCATGTCAATGGCACCCATCACGGGGGAAAACATAAGACCATTTATTAGTAGGTGTGCTGTGTGTGAGGCGCCTGCCATGGTGATGGCCGTGCACAGCCAGACCATTCAGATCCCACCGTGCCCCAGCGGGTGGTCCTCGCTGTGGATCGGCTACTCTTTTGTGATGCACACCAGCGCTGGTGCAGAAGGCTCTGGCCAAGCCCTGGCGTCCCCCGGCTCCTGCCTGGAGGAGTTTAGAAGTGCGCCATTCATCGAGTGTCACGGCCGTGGGACCTGCAATTACTACGCAAACGCTTACAGCTTTTGGCTCGCCACCATAGAGAGGAGCGAGATGTTCAAGAAGCCTACGCCGTCCACCTTGAAGGCAGGGGAGCTGCGCACGCACGTCAGCCGCTGCCAAGTCTGTATGAGAAGAACATAATGAAGCCTGACTCAGCTAATGTCACAACATGGTGCTACTTCTTCTTCTTTTTGTTAACAGCAACGAACCCTAGAAATATATCCTGTGTACCTCACTGTCCAATATGAAAACCGTAAAGTGCCTTATAGGAATTTGCGTAACTAACACACCCTGCTTCATTGACCTCTACTTGCTGAAGGAGAAAAAGACAGCGATAAGCTTTCAATAGTGGCATACCAAATGGCACTTTTGATGAAATAAAATATCAATATTTTCTGCAATCCAATGCACTGATGTGTGAAGTGAGAACTCCATCAGAAAACCAAAGGGTGCTAGGAGGTGTGGGTGCCTTCCATACTGTTTGCCCATTTTCATTCTTGTATTATAATTAATTTTCTACCCCCAGAGATAAATGTTTGTTTATATCACTGTCTAGCTGTTTCAAAATTTAGGTCCCTTGGTCTGTACAAATAATAGCAATGTAAAAATGGTTTTTTGAACCTCCAAATGGAATTACAGACTCAGTAGCCATATCTTCCAACCCCCCAGTATAAATTTCTGTCTTTCTGCTATGTGTGGTACTTTGCAGCTGCTTTTGCAGAAATCACAATTTTCCTGTGGAATAAAGATGGTCCAAAAATAGTCAAAAATTAAATATATATATATATTAGTAATTTATATAGATGTCAGCAATTAGGCAGATCAAGGTTTAGTTTAACTTCCACTGTTAAAATAAAGCTTACATAGTTTTCTTCCTTTGAAAGACTGTGCTGTCCTTTAACATAGGTTTTTAAAGACTAGGATATTGAATGTGAAACATCCGTTTTCATTGTTCACTTCTAAACCAAAAATTATGTGTTGCCAAAACCAAACCCAGGTTCATGAATATGGTGTCTATTATAGTGAAACATGTACTTTGAGCTTATTGTTTTTATTCTGTATTAAATATTTTCAGGGTTTTAAACACTAATCACAAACTGAATGACTTGACTTCAAAAGCAACAACCTTAAAGGCCGTCATTTCATTAGTATTCCTCATTCTGCATCCTGGCTTGAAAAACAGCTCTGTTGAATCACAGTATCAGTATTTTCACACGTAAGCACATTCGGGCCATTTCCGTGGTTTCTCATGAGCTGTGTTCACAGACCTCAGCAGGGCATCGCATGGACCGCAGGAGGGCAGATTCGGACCACTAGGCCTGAAATGACATTTCACTAAAAGTCTCCAAAACATTTCTAAGACTACTAAGGCCTTTTATGTAATTTCTTTAAATGTGTATTTCTTAAGAATTCAAATTTGTAATAAAACTATTTGTATAAAAATTAAGCTTTTATTAATTTGTTGCTAGTATTGCCACAGACGCATTAAAAGAAACTTACTGCACAAGCTGCTAATAAATTTGTAAGCTTTGCATACCTTAGATTATTTTTATTTTGCACTTCTTCCAAATGAGAGTCACAGACTGGGGGTGATTTATAGTGACTACAACAA