Transcript asmbl_44278

Sequence
Transcript Sequence for observation asmbl_44278 of TGE0058649:
GTCGGCCTGCATCACGCGTGAGGGGGCGCGCGGTGCTGGAAGCTGCCGCACCTGCGGGGAGCCGAGCCGCCGGCGCTCGACGCGCGCGCTCTCGCGAGACCCGCGGGATCACGTGACGCCCGGGCGCGGCGCAGCTCACGTGACAAGCGCTGCCGGCCGCGGTGTCTTCTTCGTGCCGGCGTCGCAGTGGCCGGGCCTCTTGCGTCTGGTAACGCCGCTGTCTCTAACGCCAGCCCTTGGCGCCCGCGCCCCGCCACCGCAGCGCCCGGCAGTCCGCGGCCCAACCGCCGCCCGCGCCCCCGCTCCCCGCACCGTACCCGGCCGCCTCGCGCCATGGCGGCCCCCGGCAGCGCCCGGCGACCCCTGCTGCTGCTACTGCTGTTGCTGCTGCTCGGCCTCATGCATTGTGCGTCAGCAGCAATGTTTATGGTGAAAAATGGCAACGGGACCGCGTGCATAATGGCCAACTTCTCTGCTGCCTTCTCAGTGAACTACGACACCAAGAGTGGCCCTAAGAACATGACCTTTGACCTGCCATCAGATGCCACAGTGGTGCTCAACCGCAGCTCCTGTGGAAAAGAGAACACTTCTGACCCCAGTCTCGTGATTGCTTTTGGAAGAGGACATACACTCACTCTCAATTTCACGAGAAATGCAACACGTTACAGCGTCCAGCTCATGAGTTTTGTTTATAACTTGTCAGACACACACCTTTTCCCCAATGCGAGCTCCAAAGAAATCAAGACTGTGGAATCTATAACTGACATCAGGGCAGATATAGATAAAAAATACAGATGTGTTAGTGGCACCCAGGTCCACATGAACAACGTGACCGTAACGCTCCATGATGCCACCATCCAGGCGTACCTTTCCAACAGCAGCTTCAGCCGGGGAGAGACACGCTGTGAACAAGACAGGCCTTCCCCAACCACAGCGCCCCCTGCGCCACCCAGCCCCTCGCCCTCACCCGTGCCCAAGAGCCCCTCTGTGGACAAGTACAACGTGAGCGGCACCAACGGGACCTGCCTGCTGGCCAGCATGGGGCTGCAGCTGAACCTCACCTATGAGAGGAAGGACAACACGACGGTGACAAGGCTTCTCAACATCAACCCCAACAAGACCTCGGCCAGCGGGAGCTGCGGCGCCCACCTGGTGACTCTGGAGCTGCACAGCGAGGGCACCACCGTCCTGCTCTTCCAGTTCGGGATGAATGCAAGTTCTAGCCGGTTTTTCCTACAAGGAATCCAGTTGAATACAATTCTTCCTGACGCCAGAGACCCTGCCTTTAAAGCTGCCAACGGCTCCCTGCGAGCGCTGCAGGCCACAGTCGGCAATTCCTACAAGTGCAACGCGGAGGAGCACGTCCGTGTCACGAAGGCGTTTTCAGTCAATATATTCAAAGTGTGGGTCCAGGCTTTCAAGGTGGAAGGTGGCCAGTTTGGCTCTGTGGAGGAGTGTCTGCTGGACGAGAACAGCATGCTGATCCCCATCGCTGTGGGTGGTGCCCTGGCGGGGCTGGTCCTCATCGTCCTCATCGCCTACCTCGTCGGCAGGAAGAGGAGTCACGCAGGCTACCAGACTATCTAGCCTGGTGCACGCAGGCACAGCAGCTGCAGGGGCCTCTGTTCCTTTCTCTGGGCTTAGGGTCCTGTCGAAGGGGAGGCACACTTTCTGGCAAACGTTTCTCAAATCTGCTTCATCCAATGTGAAGTTCATCTTGCAGCATTTACTATGCACAACAGAGTAACTATCGAAATGACGGTGTTAATTTTGCTAACTGGGTTAAATATTTTGCTAACTGGTTAAACATTAATATTTACCAAAGTAGGATTTTGAGGGTGGGGGTGC