Transcript asmbl_44277

Sequence
Transcript Sequence for observation asmbl_44277 of TGE0058648:
GTCGGCCTGCATCACGCGTGAGGGGGCGCGCGGTGCTGGAAGCTGCCGCACCTGCGGGGAGCCGAGCCGCCGGCGCTCGACGCGCGCGCTCTCGCGAGACCCGCGGGATCACGTGACGCCCGGGCGCGGCGCAGCTCACGTGACAAGCGCTGCCGGCCGCGGTGTCTTCTTCGTGCCGGCGTCGCAGTGGCCGGGCCTCTTGCGTCTGGTAACGCCGCTGTCTCTAACGCCAGCCCTTGGCGCCCGCGCCCCGCCACCGCAGCGCCCGGCAGTCCGCGGCCCAACCGCCGCCCGCGCCCCCGCTCCCCGCACCGTACCCGGCCGCCTCGCGCCATGGCGGCCCCCGGCAGCGCCCGGCGACCCCTGCTGCTGCTACTGCTGTTGCTGCTGCTCGGCCTCATGCATTGTGCGTCAGCAGCAATGTTTATGGTGAAAAATGGCAACGGGACCGCGTGCATAATGGCCAACTTCTCTGCTGCCTTCTCAGTGAACTACGACACCAAGAGTGGCCCTAAGAACATGACCTTTGACCTGCCATCAGATGCCACAGTGGTGCTCAACCGCAGCTCCTGTGGAAAAGAGAACACTTCTGACCCCAGTCTCGTGATTGCTTTTGGAAGAGGACATACACTCACTCTCAATTTCACGAGAAATGCAACACGTTACAGCGTCCAGCTCATGAGTTTTGTTTATAACTTGTCAGACACACACCTTTTCCCCAATGCGAGCTCCAAAGAAATCAAGACTGTGGAATCTATAACTGACATCAGGGCAGATATAGATAAAAAATACAGATGTGTTAGTGGCACCCAGGTCCACATGAACAACGTGACCGTAACGCTCCATGATGCCACCATCCAGGCGTACCTTTCCAACAGCAGCTTCAGCCGGGGAGAGACACGCTGTGAACAAGACAGGCCTTCCCCAACCACAGCGCCCCCTGCGCCACCCAGCCCCTCGCCCTCACCCGTGCCCAAGAGCCCCTCTGTGGACAAGTACAACGTGAGCGGCACCAACGGGACCTGCCTGCTGGCCAGCATGGGGCTGCAGCTGAACCTCACCTATGAGAGGAAGGACAACACGACGGTGACAAGGCTTCTCAACATCAACCCCAACAAGACCTCGGCCAGCGGGAGCTGCGGCGCCCACCTGGTGACTCTGGAGCTGCACAGCGAGGGCACCACCGTCCTGCTCTTCCAGTTCGGGATGAATGCAAGTTCTAGCCGGTTTTTCCTACAAGGAATCCAGTTGAATACAATTCTTCCTGACGCCAGAGACCCTGCCTTTAAAGCTGCCAACGGCTCCCTGCGAGCGCTGCAGGCCACAGTCGGCAATTCCTACAAGTGCAACGCGGAGGAGCACGTCCGTGTCACGAAGGCGTTTTCAGTCAATATATTCAAAGTGTGGGTCCAGGCTTTCAAGGTGGAAGGTGGCCAGTTTGGCTCTGGTGAGTGTCACCGAGGGCAGCTGTCGCGGGGTGTGGAGGACGTGCTTCAGACTCCGCCTGTGGACGTTTAGTCGCTTCCGTGTGGGCTGGGGCGACGCCCCTGTTCCTCTGCAAGGAGCTGTTTCTTCTTGCCGGTCTGAGATTCTAGAGGTAACTCCCCCTGCTTTAGAGAGGCCCAGCGTGTCTCTCAGCTGGGAGCCCCTGGTACCATTTGAGAGTAAGGGAATCATTTTAAGAAACAGTGGTGGCGCTTCTCCCATGAACGTTGAATACAACACTGTCATCTGATGTGCACAGAGGCCCTGGACGCAGCACAGCTGTCCGGCCACAGCCCCTGATTCCAGACGGGGGAGAGACGTGTGTGGTTTCCTCGCCGTGCAGAGAGCACCAGTCTCTGCAGCGGCTTCCCCAAGTGACAATTCCAGCTAGAGCTGGAACCTTCCGCCAGGGTTCCTCTTTGCCTTTTGGCTGATGTGGGGGAGTGGTGGGGAGAGAGGCCTGTTTGCAGGCCCCTGTGTGAGCAGAGCCCTGACACCATCCGTCTGTCTTGGCAGTGGAGGAGTGTCTGCTGGACGAGAACAGCATGCTGATCCCCATCGCTGTGGGTGGTGCCCTGGCGGGGCTGGTCCTCATCGTCCTCATCGCCTACCTCGTCGGCAGGAAGAGGAGTCACGCAGGCTACCAGACTATCTAGCCTGGTGCACGCAGGCACAGCAGCTGCAGGGGCCTCTGTTCCTTTCTCTGGGCTTAGGGTCCTGTCGAAGGGGAGGCACACTTTCTGGCAAACGTTTCTCAAATCTGCTTCATCCAATGTGAAGTTCATCTTGCAGCATTTACTATGCACAACAGAGTAACTATCGAAATGACGGTGTTAATTTTGCTAACTGGGTTAAATATTTTGCTAACTGGTTAAACATTAATATTTACCAAAGTAGGATTTTGAGGGTGGGGGTGC