Transcript asmbl_44222

Sequence
Transcript Sequence for observation asmbl_44222 of TGE0057987:
CAGCTAGCTCTCGGAAGGCCGGACTTCCAGCGCTACGCACCGTCCCGGGTGCGGCGGCTCCAAGCGGAGACCTGAGCGCGGCGGGCCGAGCTCCCCAATTTGTTGGCGCTGCCCCCTCCCCCCCGGCGGTGCGCGGGCGGCGCCTCAAAGGGGAGGACCCTGCGGCGCGGGTAAGAGGCGGCGGGAGCGCGCGGCCCGGGAGTGTGGCTGCAGTGCGCCGGGACACCAGGGCTCCGCGCTCCGCACTCAAGAGGCTCCCGCGTCCCAACCCCTCGCGCCCGCGCGTTCGCGGATCCAGGCCGAGGACCGAAAGGGGCCGCCCGAGCCCCCGGGGCCGGCGCCCAGAGAGCCCAGCAAGGCCGGCCGCCCTGCCGGTGTGCCGCCGGCGGGTGCTTCTGGAAGGGCCAATGCGTTCGGGCAGCAGCCCCTGAAGCCGAGCCCGAGGCTAAGTGGGACTGACCGGGGCCCAGAGTGGACGAACCGCCAGCATGGGGAGAGACCAGCGCGCGGTGGCCGGCCCTGCCCTACGGCGGTGGCTGCTGCTGGGGACAGTGACCGTGGGGTTCCTCGCCCAGAGCGTCTTGGCGGGTGTGAAGAAGTTTGATGTGCCGTGTGGAGGAAGAGATTGCAGTGGGGGCTGCCAGTGCTACCCTGAGAAAGGTGGACGTGGTCAGCCTGGGCCAGTGGGCCCCCAGGGGTACAATGGGCCACCAGGATTACAAGGATTCCCGGGACTGCAGGGACGTAAAGGAGACAAGGGTGAAAGGGGAGCCCCCGGAGTAACGGGACCCAAGGGCGACGTGGGAGCAAGAGGCGTTTCTGGATTCCCTGGTGCCGATGGAATTCCTGGACACCCGGGGCAAGGTGGGCCCAGGGGAAGGCCGGGCTACGATGGCTGCAACGGAACCCAGGGAGACTCAGGTCCACAGGGGCCCCCCGGCTCTGAGGGGTTCACCGGGCCTCCCGGGCCCCAAGGACCAAAAGGGCAGAAAGGTGAGCCTTATGCACTGCCTAAAGAGGAGCGCGACAGATATCGGGGTGAACCTGGAGAGCCTGGATTGGTCGGTTTCCAGGGACCTCCCGGCCGCCCTGGGCATGTGGGACAGATGGGTCCAGTTGGAGCTCCAGGGAGACCAGGACCACCTGGACCCCCTGGACCAAAAGGACAGCAAGGCAACAGAGGACTTGGTTTCTACGGAGTTAAGGGTGAAAAGGGTGACGTAGGGCAGCCGGGACCCAACGGGATTCCATCAGACACCCTCCACCCCATCATCGCGCCCACAGGAGTCACCTTCCACCCAGATCAGTACAAGGGTGAAAAAGGCAGTGAGGGGGAACCAGGAATAAGAGGCATTTCCTTGAAGGGAGAAGAAGGAATCATGGGCTTTCCTGGACTGAGGGGTTACCCTGGCTTGAGTGGTGAAAAAGGATCACCAGGACAGAAGGGAAGCCGAGGCCTGGATGGCTATCAAGGGCCTGATGGACCCCGGGGACCCAAGGGAGAAGCCGGAGACCCAGGGCCCCCTGGACTACCTGCCTACTCCCCTCACCCTTCCCTAGCAAAAGGTGCCAGAGGTGACCCGGGATTCCCAGGGGCCCAAGGGGAGCCAGGAAGCCAGGGTGAGCCAGGAGACCCGGGCCTCCCAGGTCCCCCTGGCCTCTCCATCGGAGATGGAGATCAGAGGAGAGGCCTGCCGGGTGAGATGGGACCCAAGGGCTTCATCGGAGACCCCGGCATCCCTGCGCTCTACGGGGGCCCACCTGGACCTGATGGAAAGCGAGGGCCTCCAGGACCCCCCGGGCTCCCTGGACCACCTGGACCTGATGGCTTCCTGTTTGGGCTGAAAGGAGCAAAAGGAAGAGCAGGCTTCCCTGGGCTTCCCGGCTCCCCTGGAGCCCGCGGACCAAAGGGGTGGAAAGGTGACGCTGGGGAATGCAGATGTACAGAAGGCGACGAAGCTATCAAAGGTCTTCCGGGACTGCCAGGACCCAAGGGCTTCGCAGGCATCAACGGGGAGCCGGGGAGGAAAGGGGACAGAGGAGACCCCGGCCAACACGGCCTCCCTGGGTTCCCAGGGCTCAAGGGAGTGCCTGGCAACATTGGTGCTCCCGGACCCAAAGGAGCAAAAGGAGATTCCAGAACAATCACAACCAAAGGTGAGCGGGGACAGCCCGGCGTCCCAGGTGTGCCCGGGATGAAAGGTGACGATGGCAGCCCAGGCCGCGATGGGCTCGATGGATTCCCCGGCCTCCCAGGCCCTCCCGGTGATGGCATCAAGGGCCCTCCAGGGGACCCAGGCTATCCAGGAATACCTGGAACGAAGGGTACTCCAGGAGAAATGGGCCCCCCAGGACTGGGCCTTCCCGGCCTCAAAGGCCAACGTGGTTTCCCTGGAGACGCCGGCTTACCTGGACCACCAGGCTTCCTGGGCCCTCCTGGCCCCGCAGGGACCCCAGGACAAATAGATTGTGACACAGATGTGAAAAGGGCCGTTGGAGGTGACAGACAGGAGGCCATCCAGCCAGGTTGCATAGGAGGGCCCAAGGGATTGCCAGGCCTGCCAGGACCCCCAGGCCCCACAGGTGCCAAAGGCCTCCGAGGAATCCCAGGCTTCGCAGGAGCTGATGGAGGACCAGGGCCCAGGGGCTTGCCAGGAGACGCAGGTCGTGAAGGGTTCCCAGGACCCCCAGGGTTCATAGGACCCCGAGGATCCAAAGGTGCAGTGGGCCTCCCTGGCCCAGATGGATCCCCAGGTCCCATCGGCCTGCCAGGGCCAGATGGGCCCCCTGGGGAAAGGGGCCTCCCTGGAGAAGTCCTGGGAGCTCAGCCCGGGCCACGGGGAGATGCTGGTGTGCCTGGACAGCCTGGGCTTAAAGGCCTTCCCGGAGACAGAGGCCCCCCTGGATTCAGAGGAAGCCAAGGGATGCCTGGGATGCCAGGGCTGAAGGGCCAGCCAGGCCTCCCAGGACCTTCCGGCCAGCCAGGCCTGTATGGGCCTCCAGGACTGCATGGATTCCCAGGAGCTCCTGGCCAAGAGGGGCCCTTGGGGCTGCCAGGAATCCCAGGCCGTGAAGGTCTGCCTGGTGATAGAGGGGACCCTGGGGACACAGGCGCTCCTGGCCCTGTGGGCATGAAAGGTCTCTCTGGTGACAGAGGAGATGCTGGCTTCACAGGGGAGCAAGGCCATCCAGGAAGCCCTGGATTTAAAGGAATTGATGGAATGCCTGGGACCCCCGGGCTAAAAGGAGATAGAGGCTCACCTGGGATGGATGGTTTCCAAGGCATGCCTGGACTCAAAGGGAGACCCGGGTTTCCAGGGAGCAAAGGCGAGGCTGGATTTTTCGGAATACCCGGTCTGAAGGGTCTGGCTGGTGAGCCAGGTTTTAAAGGCAGCCGAGGGGACCCTGGGCCCCCAGGACCACCTCCTGTCATCCTGCCAGGAATGAAAGACATTAAAGGAGAGAAAGGAGATGAAGGGCCTATGGGGCTGAAAGGATACCTGGGCGCAAAAGGTATCCAAGGAATGCCAGGCATCCCAGGGCTGTCAGGAATCCCTGGGCTGCCTGGGAGGCCCGGCCACATCAAAGGAGTCAAGGGAGACATCGGAGTCCCCGGCATCCCCGGTTTGCCAGGATTCCCTGGGGTGGCTGGCCCCCCTGGAATTACGGGATTCCCAGGATTCATAGGAAGCCGGGGTGACAAAGGTGCCCCAGGGAGAGCAGGCCTGTATGGCGAGATTGGCGCGACTGGTGATTTCGGTGACATCGGGGACACTATAAATTTACCAGGAAGACCAGGCCTGAAGGGGGAGCGGGGCACCACTGGAATACCAGGTCTGAAGGGATTCTTTGGAGAGAAGGGAACAGAAGGTGACATCGGCTTCCCTGGGATAACAGGCGTGACTGGAGTCCAAGGCCCTCCTGGACTTAAAGGACAAACAGGCTTTCCAGGGCTGACTGGGCCTCCAGGGTCGCAGGGAGAGCTGGGGCGGATTGGACTGCCTGGTGGCAAAGGAGATGATGGCTGGCCGGGAGCTCCGGGCTTACCAGGTTTTCCGGGACTCCGTGGGATCCGCGGCTTACACGGCTTGCCAGGCACCAAGGGCTTTCCAGGATCCCCAGGTTCTGACATCCACGGAGACCCAGGCTTCCCAGGCCCTCCTGGGGAAAGAGGTGACCCAGGAGAGGCCAACACCCTTCCAGGCCCTGTGGGAGTCCCAGGACAGAAAGGAGACCAAGGAGCTCCAGGGGAACGAGGCCCACCTGGGAGCCCAGGACTTCAGGGGTTCCCTGGTATCACACCCCCTTCCAACATCTCTGGGGCACCTGGTGACAAAGGGGCGCCAGGGATATTTGGCCTGAAAGGTAAGCAGGACTTATACATCTGTGCTTCGACATCTCTAGGGGCAGGAGCTGGCAATGGCCCGCTTAATGTAGGGGGAGAACAGACGTTCATTTCCACGCTGTGCCCAGACTCCGGTCAAAGAGGCAGGAGCCATGATGGCTCCTCCTGTGTCATTTCCATCACCTGCACGACCTGGTCCCTGGGAAGCTGAGACACAGGCCATGTCATTTACTTGCTGTAATAGCAGATATTCAAACTGCAGGGGGCTCAGAAATGTGCAGTATGAACGGCTTTCTTCTTCCTCACTGTATTGTGTTTAGACAAGTATTAAATTTAATTTGCACTTCCTAATCACGAACGAGCTGAATATTGGAAAGAGATGGCGTAAAGATGAAGTCACCCGTCAAACAAGTGTTTGTGCGTCAAGGTTCACAGCAGCACTACTCACAAGCACCGAGTGCTGAAAGCAACCCGAGTGTCCATCAACAGAGGAATTAAGAAGCAAAATGCAGTCAGTATCCACCCAGTACAAGAGGAGTCCGTCTTTTTTGTTGGGTTGTTTTCTTGTTTTTTGTTTTTTGAGACAG