Transcript asmbl_44220

Sequence
Transcript Sequence for observation asmbl_44220 of TGE0058645:
CAGCTAGCTCTCGGAAGGCCGGACTTCCAGCGCTACGCACCGTCCCGGGTGCGGCGGCTCCAAGCGGAGACCTGAGCGCGGCGGGCCGAGCTCCCCAATTTGTTGGCGCTGCCCCCTCCCCCCCGGCGGTGCGCGGGCGGCGCCTCAAAGGGGAGGACCCTGCGGCGCGGGTAAGAGGCGGCGGGAGCGCGCGGCCCGGGAGTGTGGCTGCAGTGCGCCGGGACACCAGGGCTCCGCGCTCCGCACTCAAGAGGCTCCCGCGTCCCAACCCCTCGCGCCCGCGCGTTCGCGGATCCAGGCCGAGGACCGAAAGGGGCCGCCCGAGCCCCCGGGGCCGGCGCCCAGAGAGCCCAGCAAGGCCGGCCGCCCTGCCGGTGTGCCGCCGGCGGGTGCTTCTGGAAGGGCCAATGCGTTCGGGCAGCAGCCCCTGAAGCCGAGCCCGAGGCTAAGTGGGACTGACCGGGGCCCAGAGTGGACGAACCGCCAGCATGGGGAGAGACCAGCGCGCGGTGGCCGGCCCTGCCCTACGGCGGTGGCTGCTGCTGGGGACAGTGACCGTGGGGTTCCTCGCCCAGAGCGTCTTGGCGGGTGTGAAGAAGTTTGATGTGCCGTGTGGAGGAAGAGATTGCAGTGGGGGCTGCCAGTGCTACCCTGAGAAAGGTGGACGTGGTCAGCCTGGGCCAGTGGGCCCCCAGGGGTACAATGGGCCACCAGGATTACAAGGATTCCCGGGACTGCAGGGACGTAAAGGAGACAAGGGTGAAAGGGGAGCCCCCGGAGTAACGGGACCCAAGGGCGACGTGGGAGCAAGAGGCGTTTCTGGATTCCCTGGTGCCGATGGAATTCCTGGACACCCGGGGCAAGGTGGGCCCAGGGGAAGGCCGGGCTACGATGGCTGCAACGGAACCCAGGGAGACTCAGGTCCACAGGGGCCCCCCGGCTCTGAGGGGTTCACCGGGCCTCCCGGGCCCCAAGGACCAAAAGGGCAGAAAGGTGAGCCTTATGCACTGCCTAAAGAGGAGCGCGACAGATATCGGGGTGAACCTGGAGAGCCTGGATTGGTCGGTTTCCAGGGACCTCCCGGCCGCCCTGGGCATGTGGGACAGATGGGTCCAGTTGGAGCTCCAGGGAGACCAGGACCACCTGGACCCCCTGGACCAAAAGGACAGCAAGGCAACAGAGGACTTGGTTTCTACGGAGTTAAGGGTGAAAAGGGTGACGTAGGGCAGCCGGGACCCAACGGGATTCCATCAGACACCCTCCACCCCATCATCGCGCCCACAGGAGTCACCTTCCACCCAGATCAGTACAAGGGTGAAAAAGGCAGTGAGGGGGAACCAGGAATAAGAGGCATTTCCTTGAAGGGAGAAGAAGGAATCATGGGCTTTCCTGGACTGAGGGGTTACCCTGGCTTGAGTGGTGAAAAAGGATCACCAGGACAGAAGGGAAGCCGAGGCCTGGATGGCTATCAAGGGCCTGATGGACCCCGGGGACCCAAGGGAGAAGCCGGAGACCCAGGGCCCCCTGGACTACCTGCCTACTCCCCTCACCCTTCCCTAGCAAAAGGTGCCAGAGGTGACCCGGGATTCCCAGGGGCCCAAGGGGAGCCAGGAAGCCAGGGTGAGCCAGGAGACCCGGGCCTCCCAGGTCCCCCTGGCCTCTCCATCGGAGATGGAGATCAGAGGAGAGGCCTGCCGGGTGAGATGGGACCCAAGGGCTTCATCGGAGACCCCGGCATCCCTGCGCTCTACGGGGGCCCACCTGGACCTGATGGAAAGCGAGGGCCTCCAGGACCCCCCGGGCTCCCTGGACCACCTGGACCTGATGGCTTCCTGTTTGGGCTGAAAGGAGCAAAAGGAAGAGCAGGCTTCCCTGGGCTTCCCGGCTCCCCTGGAGCCCGCGGACCAAAGGGGTGGAAAGGTGACGCTGGGGAATGCAGATGTACAGAAGGCGACGAAGCTATCAAAGGTCTTCCGGGACTGCCAGGACCCAAGGGCTTCGCAGGCATCAACGGGGAGCCGGGGAGGAAAGGGGACAGAGGAGACCCCGGCCAACACGGCCTCCCTGGGTTCCCAGGGCTCAAGGGAGTGCCTGGCAACATTGGTGCTCCCGGACCCAAAGGAGCAAAAGGAGATTCCAGAACAATCACAACCAAAGGTGAGCGGGGACAGCCCGGCGTCCCAGGTGTGCCCGGGATGAAAGGTGACGATGGCAGCCCAGGCCGCGATGGGCTCGATGGATTCCCCGGCCTCCCAGGCCCTCCCGGTGATGGCATCAAGGGCCCTCCAGGGGACCCAGGCTATCCAGGAATACCTGGAACGAAGGGTACTCCAGGAGAAATGGGCCCCCCAGGACTGGGCCTTCCCGGCCTCAAAGGCCAACGTGGTTTCCCTGGAGACGCCGGCTTACCTGGACCACCAGGCTTCCTGGGCCCTCCTGGCCCCGCAGGGACCCCAGGACAAATAGATTGTGACACAGATGTGAAAAGGGCCGTTGGAGGTGACAGACAGGAGGCCATCCAGCCAGGTTGCATAGGAGGGCCCAAGGGATTGCCAGGCCTGCCAGGACCCCCAGGCCCCACAGGTGCCAAAGGCCTCCGAGGAATCCCAGGCTTCGCAGGAGCTGATGGAGGACCAGGGCCCAGGGGCTTGCCAGGAGACGCAGGTCGTGAAGGGTTCCCAGGACCCCCAGGGTTCATAGGACCCCGAGGATCCAAAGGTGCAGTGGGCCTCCCTGGCCCAGATGGATCCCCAGGTCCCATCGGCCTGCCAGGGCCAGATGGGCCCCCTGGGGAAAGGGGCCTCCCTGGAGAAGTCCTGGGAGCTCAGCCCGGGCCACGGGGAGATGCTGGTGTGCCTGGACAGCCTGGGCTTAAAGGCCTTCCCGGAGACAGAGGCCCCCCTGGATTCAGAGGAAGCCAAGGGATGCCTGGGATGCCAGGGCTGAAGGGCCAGCCAGGCCTCCCAGGACCTTCCGGCCAGCCAGGCCTGTATGGGCCTCCAGGACTGCATGGATTCCCAGGAGCTCCTGGCCAAGAGGGGCCCTTGGGGCTGCCAGGAATCCCAGGCCGTGAAGGTCTGCCTGGTGATAGAGGGGACCCTGGGGACACAGGCGCTCCTGGCCCTGTGGGCATGAAAGGTCTCTCTGGTGACAGAGGAGATGCTGGCTTCACAGGGGAGCAAGGCCATCCAGGAAGCCCTGGATTTAAAGGAATTGATGGAATGCCTGGGACCCCCGGGCTAAAAGGAGATAGAGGCTCACCTGGGATGGATGGTTTCCAAGGCATGCCTGGACTCAAAGGGAGACCCGGGTTTCCAGGGAGCAAAGGCGAGGCTGGATTTTTCGGAATACCCGGTCTGAAGGGTCTGGCTGGTGAGCCAGGTTTTAAAGGTATGTCCCTCTCTTAACATCCTCCTTACCTGGTCATGGTGGCATCCTCC