Transcript asmbl_44219

Sequence
Transcript Sequence for observation asmbl_44219 of TGE0058644:
CAGCTAGCTCTCGGAAGGCCGGACTTCCAGCGCTACGCACCGTCCCGGGTGCGGCGGCTCCAAGCGGAGACCTGAGCGCGGCGGGCCGAGCTCCCCAATTTGTTGGCGCTGCCCCCTCCCCCCCGGCGGTGCGCGGGCGGCGCCTCAAAGGGGAGGACCCTGCGGCGCGGGTAAGAGGCGGCGGGAGCGCGCGGCCCGGGAGTGTGGCTGCAGTGCGCCGGGACACCAGGGCTCCGCGCTCCGCACTCAAGAGGCTCCCGCGTCCCAACCCCTCGCGCCCGCGCGTTCGCGGATCCAGGCCGAGGACCGAAAGGGGCCGCCCGAGCCCCCGGGGCCGGCGCCCAGAGAGCCCAGCAAGGCCGGCCGCCCTGCCGGTGTGCCGCCGGCGGGTGCTTCTGGAAGGGCCAATGCGTTCGGGCAGCAGCCCCTGAAGCCGAGCCCGAGGCTAAGTGGGACTGACCGGGGCCCAGAGTGGACGAACCGCCAGCATGGGGAGAGACCAGCGCGCGGTGGCCGGCCCTGCCCTACGGCGGTGGCTGCTGCTGGGGACAGTGACCGTGGGGTTCCTCGCCCAGAGCGTCTTGGCGGGTGTGAAGAAGTTTGATGTGCCGTGTGGAGGAAGAGATTGCAGTGGGGGCTGCCAGTGCTACCCTGAGAAAGGTGGACGTGGTCAGCCTGGGCCAGTGGGCCCCCAGGGGTACAATGGGCCACCAGGATTACAAGGATTCCCGGGACTGCAGGGACGTAAAGGAGACAAGGGTGAAAGGGGAGCCCCCGGAGTAACGGGACCCAAGGGCGACGTGGGAGCAAGAGGCGTTTCTGGATTCCCTGGTGCCGATGGAATTCCTGGACACCCGGGGCAAGGTGGGCCCAGGGGAAGGCCGGGCTACGATGGCTGCAACGGAACCCAGGGAGACTCAGGTCCACAGGGGCCCCCCGGCTCTGAGGGGTTCACCGGGCCTCCCGGGCCCCAAGGACCAAAAGGGCAGAAAGGTGAGCCTTATGCACTGCCTAAAGAGGAGCGCGACAGATATCGGGGTGAACCTGGAGAGCCTGGATTGGTCGGTTTCCAGGGACCTCCCGGCCGCCCTGGGCATGTGGGACAGATGGGTCCAGTTGGAGCTCCAGGGAGACCAGGACCACCTGGACCCCCTGGACCAAAAGGACAGCAAGGCAACAGAGGACTTGGTTTCTACGGAGTTAAGGGTGAAAAGGGTGACGTAGGGCAGCCGGGACCCAACGGGATTCCATCAGACACCCTCCACCCCATCATCGCGCCCACAGGAGTCACCTTCCACCCAGATCAGTACAAGGGTGAAAAAGGCAGTGAGGGGGAACCAGGAATAAGAGGCATTTCCTTGAAGGGAGAAGAAGGAATCATGGGCTTTCCTGGACTGAGGGGTTACCCTGGCTTGAGTGGTGAAAAAGGATCACCAGGACAGAAGGGAAGCCGAGGCCTGGATGGCTATCAAGGGCCTGATGGACCCCGGGGACCCAAGGGAGAAGCCGGAGACCCAGGGCCCCCTGGACTACCTGCCTACTCCCCTCACCCTTCCCTAGCAAAAGGTGCCAGAGGTGACCCGGGATTCCCAGGGGCCCAAGGGGAGCCAGGAAGCCAGGGTGAGCCAGGAGACCCGGGCCTCCCAGGTCCCCCTGGCCTCTCCATCGGAGATGGAGATCAGAGGAGAGGCCTGCCGGGTGAGATGGGACCCAAGGGCTTCATCGGAGACCCCGGCATCCCTGCGCTCTACGGGGGCCCACCTGGACCTGATGGAAAGCGAGGGCCTCCAGGACCCCCCGGGCTCCCTGGACCACCTGGACCTGATGGCTTCCTGTTTGGGCTGAAAGGAGCAAAAGGAAGAGCAGGCTTCCCTGGGCTTCCCGGCTCCCCTGGAGCCCGCGGACCAAAGGGGTGGAAAGGTGACGCTGGGGAATGCAGATGTACAGAAGGCGACGAAGCTATCAAAGGTCTTCCGGGACTGCCAGGACCCAAGGGCTTCGCAGGCATCAACGGGGAGCCGGGGAGGAAAGGGGACAGAGGAGACCCCGGCCAACACGGCCTCCCTGGGTTCCCAGGGCTCAAGGGAGTGCCTGGCAACATTGGTGCTCCCGGACCCAAAGGAGCAAAAGGAGATTCCAGAACAATCACAACCAAAGGTGAGCGGGGACAGCCCGGCGTCCCAGGTGTGCCCGGGATGAAAGGTGACGATGGCAGCCCAGGCCGCGATGGGCTCGATGGATTCCCCGGCCTCCCAGGCCCTCCCGGTGATGGCATCAAGGGCCCTCCAGGGGACCCAGGCTATCCAGGAATACCTGGAACGAAGGGTACTCCAGGAGAAATGGGCCCCCCAGGACTGGGCCTTCCCGGCCTCAAAGGCCAACGTGGTTTCCCTGGAGACGCCGGCTTACCTGGACCACCAGGCTTCCTGGGCCCTCCTGGCCCCGCAGGGACCCCAGGACAAATAGATTGTGACACAGATGTGAAAAGGGCCGTTGGAGGTGACAGACAGGAGGCCATCCAGCCAGGTTGCATAGGAGGGCCCAAGGGATTGCCAGGCCTGCCAGGACCCCCAGGCCCCACAGGTGCCAAAGGCCTCCGAGGAATCCCAGGCTTCGCAGGAGCTGATGGAGGACCAGGGCCCAGGGGCTTGCCAGGAGACGCAGGTCGTGAAGGGTTCCCAGGACCCCCAGGGTTCATAGGACCCCGAGGATCCAAAGGTGCAGTGGGCCTCCCTGGCCCAGATGGATCCCCAGGTCCCATCGGCCTGCCAGGGCCAGATGGGCCCCCTGGGGAAAGGGGCCTCCCTGGAGAAGTCCTGGGAGCTCAGCCCGGGCCACGGGGAGATGCTGGTGTGCCTGGACAGCCTGGGCTTAAAGGCCTTCCCGGAGACAGAGGCCCCCCTGGATTCAGAGGAAGCCAAGGGATGCCTGGGATGCCAGGGCTGAAGGGCCAGCCAGGCCTCCCAGGACCTTCCGGCCAGCCAGGCCTGTATGGGCCTCCAGGACTGCATGGATTCCCAGGAGCTCCTGGCCAAGAGGGGCCCTTGGGGCTGCCAGGAATCCCAGGCCGTGAAGGTCTGCCTGGTGATAGAGGGGACCCTGGGGACACAGGCGCTCCTGGCCCTGTGGGCATGAAAGGTCTCTCTGGTGACAGAGGAGATGCTGGCTTCACAGGGGAGCAAGGCCATCCAGGAAGCCCTGGATTTAAAGGAATTGATGGAATGCCTGGGACCCCCGGGCTAAAAGGAGATAGAGGCTCACCTGGGATGGATGGTTTCCAAGGCATGCCTGGACTCAAAGGGAGACCCGGGTTTCCAGGGAGCAAAGGCGAGGCTGGATTTTTCGGAATACCCGGTCTGAAGGGTCTGGCTGGTGAGCCAGGTTTTAAAGGCAGCCGAGGGGACCCTGGGCCCCCAGGACCACCTCCTGTCATCCTGCCAGGAATGAAAGACATTAAAGGAGAGAAAGGAGATGAAGGGCCTATGGGGCTGAAAGGATACCTGGGCGCAAAAGGTATCCAAGGAATGCCAGGCATCCCAGGGCTGTCAGGAATCCCTGGGCTGCCTGGGAGGCCCGGCCACATCAAAGGAGTCAAGGGAGACATCGGAGTCCCCGGCATCCCCGGTTTGCCAGGATTCCCTGGGGTGGCTGGCCCCCCTGGAATTACGGGATTCCCAGGATTCATAGGAAGCCGGGGTGACAAAGGTGCCCCAGGGAGAGCAGGCCTGTATGGCGAGATTGGCGCGACTGGTGATTTCGGTGACATCGGGGACACTATAAATTTACCAGGAAGACCAGGCCTGAAGGGGGAGCGGGGCACCACTGGAATACCAGGTCTGAAGGGATTCTTTGGAGAGAAGGGAACAGAAGGTGACATCGGCTTCCCTGGGATAACAGGCGTGACTGGAGTCCAAGGCCCTCCTGGACTTAAAGGACAAACAGGCTTTCCAGGGCTGACTGGGCCTCCAGGGTCGCAGGGAGAGCTGGGGCGGATTGGACTGCCTGGTGGCAAAGGAGATGATGGCTGGCCGGGAGCTCCGGGCTTACCAGGTTTTCCGGGACTCCGTGGGATCCGCGGCTTACACGGCTTGCCAGGCACCAAGGGCTTTCCAGGATCCCCAGGTTCTGACATCCACGGAGACCCAGGCTTCCCAGGCCCTCCTGGGGAAAGAGGTGACCCAGGAGAGGCCAACACCCTTCCAGGCCCTGTGGGAGTCCCAGGACAGAAAGGAGACCAAGGAGCTCCAGGGGAACGAGGCCCACCTGGGAGCCCAGGACTTCAGGGGTTCCCTGGTATCACACCCCCTTCCAACATCTCTGGGGCACCTGGTGACAAAGGGGCGCCAGGGATATTTGGCCTGAAAGGTTATCGGGGCCCACCAGGGCCACCAGGTTCTGCTGCTCTTCCTGGAAGCAAAGGTGACACAGGGAACCCAGGAGCTCCAGGAACCCCAGGGACCAAAGGATGGGCCGGGGACTCCGGGCCCCAGGGCAGGCCTGGTGTGTTTGGTCTCCCAGGAGAAAAAGGGCCCAGGGGTGAACAAGGCTTCATGGGGAACACTGGACCCACTGGGGCGGTGGGCGACAGAGGCCCCAAGGGACCCAAGGGAGACCCAGGATTCCCTGGTGCCCCCGGGACTGTGGGAGCCCCCGGGATTGCAGGAATCCCCCAGAAGATTGCCGTCCAACCAGGGACAGTGGGTCCCCAGGGGAGGCGAGGCCCCCCTGGGGCACCGGGGGAGATGGGGCCCCAGGGCCCCCCCGGAGAACCAGGTTTCCGTGGGGCTCCAGGGAAAGCTGGGCCCCAAGGAAGAGGTGGTGTGTCTGCTGTTCCCGGCTTCCGGGGAGATGAAGGACCCATAGGCCACCAGGGGCCGATTGGCCAAGAAGGAAGGGGACACACGAGAGCCCAGAAAAGCCAGAAATGAGGCGCTGCCCCACCCTCCTGCTCCTAATCTGGGCGTAGCAGCTACACTCCTATGCCCAGCAGAACACCTGGCCCCGAGTCCTGGGACAGCCTCCCTCCTTTTCCTGGGACACCTGCGGTGCTGTGGAGTGGGCGGCAGGGATCAGTAGACTTCAAGGGTCAGGATTAGACAAGGAGCCAAAAGAAACCGACTATTAAAATGTACAAGAGCCGCACTGCGAAGCCC