Transcript asmbl_43491

Sequence
Transcript Sequence for observation asmbl_43491 of TGE0056519:
CAGCGGCCGATAAATGCTATTAGAGCAGCCGCCGCGGAGCCGTCCCCGACGCCACCTCCTTTTCCTTCGCCGCAGTTTCCTCCGCCGCTGTCGGGCGTGCGGCGCTGAGGGACCCGGGCGAGCGCGCCGCGCACCGCCCCGCCGGCTCGCCTCCCTCGCCGCGTTCCGCCCTCAGTGGTCTGCCGGGCGCCCCCTCCTCCGGCCCGGGCGGGGCCTCTGATCGCCTCAAGAGAGCGGGGAGGGGGCTCGGGGGCCGCGGCCTGCCCTCCCGGCGGGCGGCTGAGGGCGAGGGAGGCCCTCCCTTCTGGCGAGGGGAGGGAGGGTGGGTCAGGAGCCCCCAACCCGCCCTGCGGAGCTCGGGGCCGCGCGAGGGGCGGTTGTCTGGGGGAGGGGGCGCGGGGTGATTCAGCGCCCGGCGAGGCGGAAGCGGCCGCAAGAGGAGGAGGGGAGAGCCCGTCCGCGCCTGGGCTCCCGGGGTGGCACGAGCCCGCGGCCGGAGTGCGAGGCGGAGGCGAGGAGGCCGCGGGGACGGGAGGCGAGGCCGGCCGGGCCCCCGAAGCCATGGAGAACGCGCACACCAAGACGGTGGAGGAGGTGCTGGGCCACTTCGGCGTCAACGAGAGTACGGGGCTGAGCCTGGAACAGGTCAAGAAGCTTAAGGAGAGATGGGGCTCCAACGAGTTACCGGCTGAAGAAGGAAAAACCTTGCTGGAACTTGTGATTGAGCAGTTTGAAGACTTGCTAGTTAGGATTTTATTACTGGCAGCATGTATATCTTTTGTTTTGGCTTGGTTTGAAGAAGGTGAAGAAACAATTACAGCCTTTGTAGAACCTTTTGTAATTTTACTCATATTAGTAGCCAATGCAATTGTGGGTGTATGGCAGGAAAGAAATGCTGAAAATGCCATCGAAGCCCTTAAGGAATATGAGCCTGAAATGGGCAAAGTGTATCGACAGGACAGAAAGAGTGTGCAGCGGATTAAAGCTAAAGACATAGTTCCTGGTGATATTGTAGAAATTGCTGTTGGTGACAAAGTTCCTGCTGATATAAGGTTAACTTCCATCAAATCTACCACACTAAGAGTTGACCAGTCAATTCTCACAGGTGAATCTGTCTCTGTCATCAAGCACACTGATCCCGTCCCTGACCCACGAGCTGTCAACCAAGATAAAAAGAACATGCTGTTTTCTGGTACAAACATTGCTGCTGGGAAAGCTATGGGAGTGGTGGTAGCAACTGGAGTTAACACCGAAATTGGCAAGATCCGGGATGAAATGGTGGCAACAGAACAGGAGAGAACACCCCTTCAGCAAAAACTAGATGAATTTGGGGAACAGCTTTCCAAAGTCATCTCCCTTATTTGCATTGCAGTCTGGATCATAAATATTGGGCACTTCAATGACCCGGTTCATGGAGGGTCCTGGATCAGAGGTGCTATTTACTACTTTAAAATTGCAGTGGCCCTGGCTGTAGCAGCCATTCCTGAAGGTCTGCCTGCAGTCATCACCACCTGCCTGGCTCTTGGAACTCGCAGAATGGCAAAGAAAAATGCCATTGTTCGAAGCCTCCCGTCTGTGGAAACCCTTGGTTGTACTTCTGTTATCTGCTCAGACAAGACTGGTACACTTACAACAAACCAGATGTCAGTCTGCAGGATGTTCATTCTGGACAGAGTGGAAGGTGATACTTGTTCCCTTAATGAGTTTACCATAACTGGATCAACTTATGCACCTATTGGAGAAGTGCATAAAGATGATAAACCAGTGAATTGTCACCAGTATGATGGTCTGGTAGAATTAGCAACAATTTGTGCTCTTTGTAATGACTCTGCTTTGGATTACAATGAGGCAAAGGGTGTGTATGAAAAAGTTGGAGAAGCTACAGAGACTGCTCTCACTTGCCTAGTAGAGAAGATGAATGTATTTGATACCGAATTGAAGGGTCTTTCTAAAATAGAACGTGCAAATGCCTGCAACTCAGTCATTAAACAGCTGATGAAAAAGGAATTCACTCTAGAGTTTTCACGTGACAGAAAGTCAATGTCGGTTTACTGTACACCAAATAAACCAAGCAGGACATCAATGAGCAAGATGTTTGTGAAGGGTGCTCCTGAAGGTGTCATTGACAGGTGCACCCACATTCGAGTTGGAAGTACTAAGGTTCCTATGACCTCTGGAGTCAAACAGAAGATCATGTCTGTCATTCGAGAGTGGGGTAGTGGCAGCGACACACTGCGATGCCTGGCCCTGGCCACTCATGACAACCCACTGAGAAGAGAAGAAATGCACCTTGAGGACTCTGCCAACTTTATTAAATATGAGACCAATCTGACCTTCGTTGGCTGCGTGGGCATGCTGGATCCTCCGAGAATCGAGGTGGCCTCCTCCGTGAAGCTGTGCCGGCAAGCAGGCATCCGGGTCATCATGATCACTGGGGACAACAAGGGCACTGCTGTGGCCATCTGTCGCCGCATCGGCATCTTCGGGCAGGATGAGGACGTGACGTCAAAAGCTTTCACAGGCCGGGAGTTTGATGAACTCAACCCCTCCGCCCAGCGAGACGCCTGCCTGAACGCCCGCTGTTTTGCTCGAGTTGAACCCTCCCACAAGTCTAAAATCGTAGAATTTCTTCAGTCTTTTGATGAGATTACAGCTATGACTGGCGATGGCGTGAACGATGCTCCTGCTCTGAAGAAAGCCGAGATTGGCATTGCTATGGGCTCTGGCACTGCGGTGGCTAAAACCGCCTCTGAGATGGTCCTGGCGGATGACAACTTCTCCACCATTGTGGCTGCCGTTGAGGAGGGGCGGGCAATCTACAACAACATGAAACAGTTCATCCGCTACCTCATCTCGTCCAACGTCGGGGAAGTTGTCTGTATTTTCCTGACAGCAGCCCTTGGATTTCCCGAGGCTTTGATTCCTGTTCAGCTGCTCTGGGTCAATCTGGTGACAGATGGCCTGCCTGCCACTGCACTGGGGTTCAACCCTCCTGATCTGGACATCATGAATAAACCTCCCCGGAACCCAAAGGAACCATTGATCAGCGGGTGGCTCTTTTTCCGTTACTTGGCTATTGGCTGTTACGTCGGCGCTGCTACCGTGGGTGCTGCTGCATGGTGGTTCATTGCTGCTGACGGTGGTCCAAGAGTGTCCTTCTACCAGCTGAGTCATTTCCTACAGTGTAAAGAGGACAACCCGGACTTTGAAGGCGTGGATTGTGCAATCTTTGAATCCCCATACCCGATGACAATGGCGCTCTCTGTTCTAGTAACTATAGAAATGTGTAACGCCCTCAACAGCTTGTCCGAAAACCAGTCCTTGCTGAGGATGCCCCCCTGGGAGAACATCTGGCTCGTGGGCTCCATCTGCCTGTCCATGTCACTCCACTTCCTGATCCTCTATGTCGAACCCTTGCCACTCATCTTCCAGATCACACCGCTGAACGTGACCCAGTGGCTGATGGTGCTGAAAATCTCCTTGCCCGTGATTCTCATGGATGAGACGCTCAAGTTTGTGGCCCGCAACTACCTGGAACCTGGTAAAGAGTGTGTGCAGCCTGCCACCAAATCCTGCTCGTTCTCGGCATGCACCGATGGGATTTCCTGGCCGTTTGTGCTGCTCATAATGCCCCTGGTGATCTGGGTCTATAGCACAGACACTAACTTTAGCGATATGTTCTGGTCTTGACTGACAGTTTTCCATAAAGAAGATGTTTAACTTAATCAATTAATTTTTTTATTGTTTAAAGCAACTGTCTATTTCTGCTGAATTTTCACATGAACATACTGGCTGGTGATGGAGGTTTCATACTCTAGATTTTGTTTTGCTTTTTCTGACTCCAGTGGGGCAAGATTTTCCTTTTTTATACACATAATTAAAGTGTCCATTGACATGTACAGAGAACTAACACTATTTTATGCAAATATTTTTTTGTAGATGAAAAAGCATGTACAGTGTTCTGTTTAATACTCATCCTTGTATAAAAAAAATAGTTGAGCCAGCAGACATTGTCAGCAAATTAATTGGCAGCAGATTTTAGGAAATGAATGTGTGTGGTTTTTTTTCTAAAACTAAATAGCATGTATTGTGTCTTTTGCATGATGATCCGGATTTAATTTGATATCACAGTCTAATTTTTATTCATAAGCCAATTTTTCTGCACTGAGCAGAGTCTTGCTACCTCAGTCAGTATTGTTTTGGTTTGCTACTTCCCTCACCCACTTTGGCCTCCGTTCACCCCACCCCACCCCACCTCTCCCCACCTTACCCCCGCCCCGCTTGGCTTCTTCTTTAGGATTGTGATGGTTCGTTCTGTTTACATCAGTTTTAACGAGAGGTATGCCTGTACTCGCTTGTGCAGAAAACATTGTTCCAGATTCAATCGACTGGGTTTATGTCCCTTCACATAGTTTTTAAGGTTATTTATTTAAATGTCTAATGTATTTTATTGTAACAGACATTGTTTTGCCAACATTGCCTATTTCAGTGGCACGTCATCTAGTTTTAAAAAAATAAAACATTTTAAATGGACAGAGAAAAATAACTGTCTTGTCTTTAACTCGTAAGTGGCTTACCTGGGACTAACAGACATGTCCAACTTTCTCTCCAGTTCTTAGCTCAGAACTTTAGTTGTACTCTGCTTGAGGGGAAGAAGGCTCCTGCTCTGCTGTGTAGGTAGTCATAGGAATTGTATTCTTAATGTACAGGCACTAATTGTCATCTGTGATGTACATTTTATGCAAGTTTCTGCTGGCCTGGTATAGAGAACATAAGGGCAAGTGTGTATGTGTGTGTATGTGTGTGTTTTGTAAAATCTGTAAATAGCACATGACCAAATGAACATATTGTATAGAACTATTTTTATTTGAATGTGGCACTAACCACCACCACCGTTACTACGATCAATGTTTGCGCATGTTCGAGATGAGTCTCACCAACAGTGTGTAAGTCATTAACAGTCCTAACTGTGGTGTTTTCCTCCAATGCCTTCCAACATCCATCAACTAACGTGAGTATTTTCTTCCTGGGATTTGGATGCTTTAGCCTAAAGGTGACTGCCACCAAGTGAGATAACTGTATGTCACTAACTTATAAGCCGCCTCCATGGCAGATGCTGCTGTGCTCCCTGATGCCCTGTGAGCACCGGGGTTGCCTGTGGCGCCTGCCATGTGACTCGGGCGCAGCATCAGCTGGCTGGAGGTGTGGCTTTCATAGACCTCCACAGGCTGCCTAGGACAAGATGACCAGGAGGGCCCAAGCCAGACAAAAGCCGGAGTGGGGAGAGAGGCATTTCAGCCAGACCAACAGGCTGAAGGAGCTGTGCAGACTATTGCTAAAATGAGGGTTCGCAGCTGCCAGGAGTCATCCCAGAACATTGCTACTTATTTATTAAAAAGCTAAAAACTAGTGAAAGCAAGTAACTGAACCAGTGAACTCTGGGTATCGATAGGTTCGTCTTAAATAGGCCACTTCCCCACTCCCCCACCCCCCCTTGCTTGGTCTTGTCCTTGGTGGCTAAGACTTAGCTCTGCAGGGGATGTTAAAGCACAGTTAGTAGGACGTGGCTCTGCACAGCCCAAAAACCAGCTTACTCCTTAGCCAGGGTGTGAGGCCTCGACTATATTCTTCAAAATGTACTTAGGCTCTGGTTACTGGGATGGCCAGTAGATGTAATGCAGATGGTTGGAGTTTGGGGAGGGTTAGGAGGCATCAAGCAGGACAAGGTGCTGCTGAGTTCAGAGGGCCCACGTTCAAGGGATGGAGGTGGAACCTGGAGACCGACTCTTAAAAGCACAGTCCGTGGTTGGGTGTGGTGGCTCATGCCTGTA