Transcript asmbl_43490

Sequence
Transcript Sequence for observation asmbl_43490 of TGE0056518:
CAGCGGCCGATAAATGCTATTAGAGCAGCCGCCGCGGAGCCGTCCCCGACGCCACCTCCTTTTCCTTCGCCGCAGTTTCCTCCGCCGCTGTCGGGCGTGCGGCGCTGAGGGACCCGGGCGAGCGCGCCGCGCACCGCCCCGCCGGCTCGCCTCCCTCGCCGCGTTCCGCCCTCAGTGGTCTGCCGGGCGCCCCCTCCTCCGGCCCGGGCGGGGCCTCTGATCGCCTCAAGAGAGCGGGGAGGGGGCTCGGGGGCCGCGGCCTGCCCTCCCGGCGGGCGGCTGAGGGCGAGGGAGGCCCTCCCTTCTGGCGAGGGGAGGGAGGGTGGGTCAGGAGCCCCCAACCCGCCCTGCGGAGCTCGGGGCCGCGCGAGGGGCGGTTGTCTGGGGGAGGGGGCGCGGGGTGATTCAGCGCCCGGCGAGGCGGAAGCGGCCGCAAGAGGAGGAGGGGAGAGCCCGTCCGCGCCTGGGCTCCCGGGGTGGCACGAGCCCGCGGCCGGAGTGCGAGGCGGAGGCGAGGAGGCCGCGGGGACGGGAGGCGAGGCCGGCCGGGCCCCCGAAGCCATGGAGAACGCGCACACCAAGACGGTGGAGGAGGTGCTGGGCCACTTCGGCGTCAACGAGAGTACGGGGCTGAGCCTGGAACAGGTCAAGAAGCTTAAGGAGAGATGGGGCTCCAACGAGTTACCGGCTGAAGAAGGAAAAACCTTGCTGGAACTTGTGATTGAGCAGTTTGAAGACTTGCTAGTTAGGATTTTATTACTGGCAGCATGTATATCTTTTGTTTTGGCTTGGTTTGAAGAAGGTGAAGAAACAATTACAGCCTTTGTAGAACCTTTTGTAATTTTACTCATATTAGTAGCCAATGCAATTGTGGGTGTATGGCAGGAAAGAAATGCTGAAAATGCCATCGAAGCCCTTAAGGAATATGAGCCTGAAATGGGCAAAGTGTATCGACAGGACAGAAAGAGTGTGCAGCGGATTAAAGCTAAAGACATAGTTCCTGGTGATATTGTAGAAATTGCTGTTGGTGACAAAGTTCCTGCTGATATAAGGTTAACTTCCATCAAATCTACCACACTAAGAGTTGACCAGTCAATTCTCACAGGTGAATCTGTCTCTGTCATCAAGCACACTGATCCCGTCCCTGACCCACGAGCTGTCAACCAAGATAAAAAGAACATGCTGTTTTCTGGTACAAACATTGCTGCTGGGAAAGCTATGGGAGTGGTGGTAGCAACTGGAGTTAACACCGAAATTGGCAAGATCCGGGATGAAATGGTGGCAACAGAACAGGAGAGAACACCCCTTCAGCAAAAACTAGATGAATTTGGGGAACAGCTTTCCAAAGTCATCTCCCTTATTTGCATTGCAGTCTGGATCATAAATATTGGGCACTTCAATGACCCGGTTCATGGAGGGTCCTGGATCAGAGGTGCTATTTACTACTTTAAAATTGCAGTGGCCCTGGCTGTAGCAGCCATTCCTGAAGGTCTGCCTGCAGTCATCACCACCTGCCTGGCTCTTGGAACTCGCAGAATGGCAAAGAAAAATGCCATTGTTCGAAGCCTCCCGTCTGTGGAAACCCTTGGTTGTACTTCTGTTATCTGCTCAGACAAGACTGGTACACTTACAACAAACCAGATGTCAGTCTGCAGGATGTTCATTCTGGACAGAGTGGAAGGTGATACTTGTTCCCTTAATGAGTTTACCATAACTGGATCAACTTATGCACCTATTGGAGAAGTGCATAAAGATGATAAACCAGTGAATTGTCACCAGTATGATGGTCTGGTAGAATTAGCAACAATTTGTGCTCTTTGTAATGACTCTGCTTTGGATTACAATGAGGCAAAGGGTGTGTATGAAAAAGTTGGAGAAGCTACAGAGACTGCTCTCACTTGCCTAGTAGAGAAGATGAATGTATTTGATACCGAATTGAAGGGTCTTTCTAAAATAGAACGTGCAAATGCCTGCAACTCAGTCATTAAACAGCTGATGAAAAAGGAATTCACTCTAGAGTTTTCACGTGACAGAAAGTCAATGTCGGTTTACTGTACACCAAATAAACCAAGCAGGACATCAATGAGCAAGATGTTTGTGAAGGGTGCTCCTGAAGGTGTCATTGACAGGTGCACCCACATTCGAGTTGGAAGTACTAAGGTTCCTATGACCTCTGGAGTCAAACAGAAGATCATGTCTGTCATTCGAGAGTGGGGTAGTGGCAGCGACACACTGCGATGCCTGGCCCTGGCCACTCATGACAACCCACTGAGAAGAGAAGAAATGCACCTTGAGGACTCTGCCAACTTTATTAAATATGAGACCAATCTGACCTTCGTTGGCTGCGTGGGCATGCTGGATCCTCCGAGAATCGAGGTGGCCTCCTCCGTGAAGCTGTGCCGGCAAGCAGGCATCCGGGTCATCATGATCACTGGGGACAACAAGGGCACTGCTGTGGCCATCTGTCGCCGCATCGGCATCTTCGGGCAGGATGAGGACGTGACGTCAAAAGCTTTCACAGGCCGGGAGTTTGATGAACTCAACCCCTCCGCCCAGCGAGACGCCTGCCTGAACGCCCGCTGTTTTGCTCGAGTTGAACCCTCCCACAAGTCTAAAATCGTAGAATTTCTTCAGTCTTTTGATGAGATTACAGCTATGACTGGCGATGGCGTGAACGATGCTCCTGCTCTGAAGAAAGCCGAGATTGGCATTGCTATGGGCTCTGGCACTGCGGTGGCTAAAACCGCCTCTGAGATGGTCCTGGCGGATGACAACTTCTCCACCATTGTGGCTGCCGTTGAGGAGGGGCGGGCAATCTACAACAACATGAAACAGTTCATCCGCTACCTCATCTCGTCCAACGTCGGGGAAGTTGTCTGTATTTTCCTGACAGCAGCCCTTGGATTTCCCGAGGCTTTGATTCCTGTTCAGCTGCTCTGGGTCAATCTGGTGACAGATGGCCTGCCTGCCACTGCACTGGGGTTCAACCCTCCTGATCTGGACATCATGAATAAACCTCCCCGGAACCCAAAGGAACCATTGATCAGCGGGTGGCTCTTTTTCCGTTACTTGGCTATTGGCTGTTACGTCGGCGCTGCTACCGTGGGTGCTGCTGCATGGTGGTTCATTGCTGCTGACGGTGGTCCAAGAGTGTCCTTCTACCAGCTGAGTCATTTCCTACAGTGTAAAGAGGACAACCCGGACTTTGAAGGCGTGGATTGTGCAATCTTTGAATCCCCATACCCGATGACAATGGCGCTCTCTGTTCTAGTAACTATAGAAATGTGTAACGCCCTCAACAGGTTAGTGCACCTTCACGGCAGGCTGAGGCGAGCATGGTGACTGCCAGGGCACCGGGGAATTGTGTGTAGTCACGGTTGATTGAGGATCACAGGACAGTTCTTCCCTTCCCAAAAGAAAGGAGAACAGGCAATACCAGTTTTAAAAGCATGAGCTGTCGTCACCTCCAGGAAGTAGTGGGAGTGCTTAGCCCTGTGTTTCTTAGGAGCTCTTCCTTAAAAGAAACCGTGGGGGCCAAAAATAGGAACTTTGGTACCCCTGTATGCCAGCACCCACAGGGAAGGAACCTCACCCTTTCACACAGACAAATGGTACCATCCAGTTAAGCCCGTGACAAAAATGGAAATTTCTAAATAGCCCAAGTCTCCAGGGCAATTGGGAACAGCTTTGAACCCACTAAGATGGGGTCTGCTATGCCAAAACATAGATACAGAATTCACAGTTTGTCCTGCATTAGGACATTCTCTTCAACTTTGCCACTGTAGAAAGTGGAGG