Transcript asmbl_43395

Sequence
Transcript Sequence for observation asmbl_43395 of TGE0056782:
GGTGAAAAGCGGCCCGACCTGCTTGCGGTGTAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGGGGGTGGAGGCGGCTCCTGCGATCGAAGGGGACTTGAGACTCACCGGCCGCACGCCATGAGGGCCCTGTGGGTGCTGGGCCTCTGCTGCGTCCTGCTGACCTTCGGGTCGGTCAGAGCTGACGATGAAGTTGATGTGGATGGTACAGTAGAAGAGGATCTGGGTAAAAGTAGAGAAGGATCAAGGACGGATGATGAAGTAGTACAGAGAGAGGAAGAAGCTATTCAGTTGGATGGATTAAATGCATCACAAATAAGAGAACTTAGAGAGAAGTCGGAAAAGTTTGCCTTCCAAGCCGAAGTTAACAGAATGATGAAACTTATCATCAATTCATTGTATAAAAATAAAGAGATTTTCCTGAGAGAACTGATTTCAAATGCTTCTGATGCTTTAGATAAGATAAGGCTAATATCACTGACTGATGAAAATGCTCTTTCTGGAAATGAGGAACTAACAGTCAAAATTAAGTGTGATAAGGAGAAGAACCTGCTGCATGTCACAGACACCGGTGTAGGAATGACCAGAGAAGAGTTGGTTAAAAACCTTGGTACCATAGCCAAATCTGGGACAAGCGAGTTTTTAAACAAAATGACTGAAGCACAGGAAGATGGCCAGTCAACTTCTGAATTGATTGGCCAGTTTGGTGTCGGTTTCTATTCCGCCTTCCTTGTAGCAGATAAGGTTATTGTCACTTCAAAACACAACAACGATACCCAGCACATCTGGGAGTCTGACTCCAATGAATTTTCTGTAATTGCTGACCCAAGAGGAAACACTCTAGGACGGGGAACGACAATTACCCTTGTCTTAAAAGAAGAAGCATCTGATTACCTTGAATTGGATACAATTAAAAATCTCGTCAAAAAATATTCACAGTTCATAAACTTTCCTATTTATGTATGGAGCAGCAAGACTGAAACTGTTGAGGAGCCCATGGAGGAAGAAGAAGCAGCCAAAGAAGAGAAAGAAGAATCTGATGATGAAGCTGCAGTAGAGGAAGAAGAAGAAGAAAAGAAACCAAAGACTAAAAAAGTTGAAAAAACTGTCTGGGACTGGGAACTTATGAATGATATCAAACCAATATGGCAGAGACCATCAAAAGAAGTAGAAGAAGATGAATACAAAGCTTTCTACAAATCATTTTCAAAGGAAAGTGATGACCCCATGGCTTATATTCACTTTACTGCTGAAGGGGAAGTTACCTTCAAATCAATTTTATTTGTACCCACATCTGCTCCACGTGGTCTGTTTGACGAATATGGATCTAAAAAGAGCGATTACATTAAGCTCTATGTGCGCCGTGTATTCATCACAGACGACTTCCATGATATGATGCCTAAATACCTCAATTTTGTCAAGGGTGTGGTGGACTCAGATGATCTCCCCTTGAATGTTTCCCGCGAGACTCTTCAGCAACATAAACTGCTTAAGGTGATTAGGAAGAAGCTTGTTCGTAAAACGCTGGACATGATCAAGAAGATTGCTGATGATAAATACAATGATACTTTTTGGAAAGAATTTGGTACCAACATCAAGCTTGGTGTGATTGAAGACCACTCGAATCGAACACGTCTTGCTAAACTTCTTAGGTTCCAGTCTTCTCATCATCCAACTGACATTACTAGCCTAGACCAGTATGTGGAAAGAATGAAGGAAAAACAAGACAAAATCTACTTCATGGCTGGGTCCAGCAGAAAAGAGGCTGAATCTTCTCCATTTGTTGAGCGACTTCTGAAAAAGGGCTATGAAGTTATTTACCTCACAGAACCTGTGGATGAATACTGTATTCAGGCCCTTCCCGAATTTGATGGGAAGAGGTTCCAGAATGTTGCCAAGGAAGGAGTGAAGTTCGATGAAAGTGAGAAAACTAAGGAGAGTCGTGAAGCAGTTGAGAAAGAATTTGAGCCTCTGCTGAATTGGATGAAAGATAAAGCCCTTAAGGACAAGGTACTGTGGAAATTACAAATTGTGGAAATATTAGTATCAGCATTTAAGAGAAAGTTATTTTGTGAACAAATTAAGCTGCAGCTGGTTACTTTGTAACCATTAGAATGGTAAAAATTTAATTAATGTAATTAAATTATTGGGAGAAAGCTTAAAACTTTCGACAATACTGCTTTGTTAATAACTTGTTACAAATTAAATTTTATGTTTTTAAAAGGTGGTATTTAAACTTCTGACTAGAAAATTCAGATTATCAAGTAAGTGCCCCTACAAATTCTCCTAAACCTTAAGAAAAGCTATTTTTATGACCTGCTTCTGTGTTTATGATCTTAAGTGATAAAGTCTTAGACAGTTGAAAGACAATTGCTCAATGACCTTACCTGTTGATATTAATTTATATGACTTGATTTCTTTCCCTAAGATTGAAAAGGCTGTGGTGTCTCAGCGCCTGACAGAATCTCCGTGTGCTTTGGTGGCCAGCCAGTACGGATGGTCTGGCAACATGGAGAGAATCATGAAAGCACAAGCGTACCAAACGGGCAAGGACATCTCTACAAATTACTATGCGAGTCAGAAGAAAACATTTGAAATTAATCCCAGACACCCGCTGATCAGAGACATGCTTCGACGAATTAAGGAAGATGAAGATGATAAAACAGTTTTGGATCTTGCTGTGGTTTTGTTTGAAACAGCAACGCTTCGGTCAGGGTATCTTTTACCAGACACTAAAGCATATGGAGATAGAATAGAAAGAATGCTTCGCCTCAGTTTGAACATTGACCCTGATGCAAAGGTGGAAGAAGAGCCCGAAGAAGAACCTGAAGAGACAGCAGAAGACACAACAGAAGACACAGAGCAAGACGAAGATGAAGAAATGGATGTGGGAACAGATGAAGAAGAAGAAACAGCAAAGGAATCTACAGCTGAAAAAGATGAATTGTAAATTATACTCTCACCATTTGGATCCTGTGTGGAGAGGGAATGTGAAATTTACATCATTTCTTTTTGGGAGAGACTTGTTTTGGATGCCCCCTAATCCCCTTCTCCCCTGCACTGTAAAATGTGGGATTATGGGTCACAGGAAAAAGTGGGTTTTTTAGTTGAATTTTTTTTAACATTCCTCATGAATGTAAATTTGTACTATTTAACTGACTATTCTTGATGTAAAATCTTGTCATGTGTATAAAAATAAAAAAGATCCCAAATA