Transcript asmbl_43394

Sequence
Transcript Sequence for observation asmbl_43394 of TGE0058643:
GGTGAAAAGCGGCCCGACCTGCTTGCGGTGTAGTGGGCGGACCGCGCGGCTGGAGGTGTGAGGATCCGAACCCAGGGGTGGGGGGTGGAGGCGGCTCCTGCGATCGAAGGGGACTTGAGACTCACCGGCCGCACGCCATGAGGGCCCTGTGGGTGCTGGGCCTCTGCTGCGTCCTGCTGACCTTCGGGTCGGTCAGAGCTGACGATGAAGTTGATGTGGATGGTACAGTAGAAGAGGATCTGGGTAAAAGTAGAGAAGGATCAAGGACGGATGATGAAGTAGTACAGAGAGAGGAAGAAGCTATTCAGTTGGATGGATTAAATGCATCACAAATAAGAGAACTTAGAGAGAAGTCGGAAAAGTTTGCCTTCCAAGCCGAAGTTAACAGAATGATGAAACTTATCATCAATTCATTGTATAAAAATAAAGAGATTTTCCTGAGAGAACTGATTTCAAATGCTTCTGATGCTTTAGATAAGATAAGGCTAATATCACTGACTGATGAAAATGCTCTTTCTGGAAATGAGGAACTAACAGTCAAAATTAAGTGTGATAAGGAGAAGAACCTGCTGCATGTCACAGACACCGGTGTAGGAATGACCAGAGAAGAGTTGGTTAAAAACCTTGGTACCATAGCCAAATCTGGGACAAGCGAGTTTTTAAACAAAATGACTGAAGCACAGGAAGATGGCCAGTCAACTTCTGAATTGATTGGCCAGTTTGGTGTCGGTTTCTATTCCGCCTTCCTTGTAGCAGATAAGGTTATTGTCACTTCAAAACACAACAACGATACCCAGCACATCTGGGAGTCTGACTCCAATGAATTTTCTGTAATTGCTGACCCAAGAGGAAACACTCTAGGACGGGGAACGACAATTACCCTTGTCTTAAAAGAAGAAGCATCTGATTACCTTGAATTGGATACAATTAAAAATCTCGTCAAAAAATATTCACAGTTCATAAACTTTCCTATTTATGTATGGAGCAGCAAGACTGAAACTGTTGAGGAGCCCATGGAGGAAGAAGAAGCAGCCAAAGAAGAGAAAGAAGAATCTGATGATGAAGCTGCAGTAGAGGAAGAAGAAGAAGAAAAGAAACCAAAGACTAAAAAAGTTGAAAAAACTGTCTGGGACTGGGAACTTATGAATGATATCAAACCAATATGGCAGAGACCATCAAAAGAAGTAGAAGAAGATGAATACAAAGCTTTCTACAAATCATTTTCAAAGGAAAGTGATGACCCCATGGCTTATATTCACTTTACTGCTGAAGGGGAAGTTACCTTCAAATCAATTTTATTTGTACCCACATCTGCTCCACGTGGTCTGTTTGACGAATATGGATCTAAAAAGAGCGATTACATTAAGCTCTATGTGCGCCGTGTATTCATCACAGACGACTTCCATGATATGATGCCTAAATACCTCAATTTTGTCAAGGGTGTGGTAAGTATCTGAAGTTTGGGAGAAGGGGTGATTGTTGTGGGGGTCTGGCAGTGTAGAGTGTTTGTTTGGCTTTGCTTTCTTCCAGTGGTTTTATTGCTCACTGAACTTTCTTTTGCCATCTGAAGGTGGACTCAGATGATCTCCCCTTGAATGTTTCCCGCGAGACTCTTCAGCAACATAAACTGCTTAAGGTGATTAGGAAGAAGCTTGTTCGTAAAACGCTGGACATGATCAAGAAGATTGCTGATGATAAATACAATGATACTTTTTGGAAAGAATTTGGTACCAACATCAAGCTTGGTGTGATTGAAGACCACTCGAATCGAACACGTCTTGCTAAACTTCTTAGGTTCCAGTCTTCTCATCATCCAACTGACATTACTAGCCTAGACCAGTATGTGGAAAGAATGAAGGAAAAACAAGACAAAATCTACTTCATGGCTGGGTCCAGCAGAAAAGAGGCTGAATCTTCTCCATTTGTTGAGCGACTTCTGAAAAAGGGCTATGAAGTTATTTACCTCACAGAACCTGTGGATGAATACTGTATTCAGGCCCTTCCCGAATTTGATGGGAAGAGGTTCCAGAATGTTGCCAAGGAAGGAGTGAAGTTCGATGAAAGTGAGAAAACTAAGGAGAGTCGTGAAGCAGTTGAGAAAGAATTTGAGCCTCTGCTGAATTGGATGAAAGATAAAGCCCTTAAGGACAAGATTGAAAAGGCTGTGGTGTCTCAGCGCCTGACAGAATCTCCGTGTGCTTTGGTGGCCAGCCAGTACGGATGGTCTGGCAACATGGAGAGAATCATGAAAGCACAAGCGTACCAAACGGGCAAGGACATCTCTACAAATTACTATGCGAGTCAGAAGAAAACATTTGAAATTAATCCCAGACACCCGCTGATCAGAGACATGCTTCGACGAATTAAGGAAGATGAAGATGATAAAACAGTTTTGGATCTTGCTGTGGTTTTGTTTGAAACAGCAACGCTTCGGTCAGGGTATCTTTTACCAGACACTAAAGCATATGGAGATAGAATAGAAAGAATGCTTCGCCTCAGTTTGAACATTGACCCTGATGCAAAGGTGGAAGAAGAGCCCGAAGAAGAACCTGAAGAGACAGCAGAAGACACAACAGAAGACACAGAGCAAGACGAAGATGAAGAAATGGATGTGGGAACAGATGAAGAAGAAGAAACAGCAAAGGAATCTACAGCTGAAAAAGATGAATTGTAAATTATACTCTCACCATTTGGATCCTGTGTGGAGAGGGAATGTGAAATTTACATCATTTCTTTTTGGGAGAGACTTGTTTTGGATGCCCCCTAATCCCCTTCTCCCCTGCACTGTAAAATGTGGGATTATGGGTCACAGGAAAAAGTGGGTTTTTTAGTTGAATTTTTTTTAACATTCCTCATGAATGTAAATTTGTACTATTTAACTGACTATTCTTGATGTAAAATCTTGTCATGTGTATAAAAATAAAAAAGATCCCAAATA