Transcript asmbl_43261

Sequence
Transcript Sequence for observation asmbl_43261 of TGE0058642:
GGTCCCGAGCACGAGCTGTGAGGGGATTCACTTGTGTGCGGAACTCCTCGGAACCATGGCGTCCCTTTCCCTTGCACCTGTTAACATCTTTAAGGCAGGAGCTGATGAAGAGAGAGCAGAGACAGCTCGTCTGACTTCTTTTATTGGTGCCATCGCCATTGGAGACTTGGTAAAGAGCACCTTGGGACCCAAAGGCATGGACAAAATTCTTCTAAGCAGTGGACGAGATGCCTCTCTTATGGTAACCAATGATGGTGCCACTATTCTAAAAAACATTGGTGTTGACAATCCAGCAGCTAAAGTTTTAGTTGATATGTCAAGGGTTCAAGATGATGAAGTTGGTGATGGCACTACCTCTGTTACCGTTTTAGCAGCAGAATTATTAAGGGAAGCAGAATCTTTAATTGCAAAAAAGATTCATCCACAGACCATCATAGCGGGTTGGAGAGAAGCCACGAAGGCTGCAAGAGAGGCGCTGTTGAGTTCTGCAGTTGATCATGGTTCCGATGAAGTTAAATTCCGTCAAGATTTAATGAATATTGCGGGCACAACATTATCCTCAAAACTTCTTACTCATCACAAAGACCACTTTACAAAGTTAGCTGTAGAAGCAGTTCTCAGACTGAAAGGCTCTGGCAACCTGGAGGCAATTCATATTATCAAGAAGCTAGGAGGAAGTTTGGCAGATTCCTATTTAGATGAAGGCTTCCTGTTGGATAAAAAAATTGGAGTAAATCAACCAAAACGAATTGAAAATGCTAAAATTCTTATTGCAAATACTGGTATGGATACAGACAAAATAAAGATATTTGGTTCCCGGGTAAGAGTTGACTCTACAGCAAAGGTTGCAGAAATAGAACATGCGGAAAAGGAAAAAATGAAGGAGAAAGTTGAACGTATTCTTAAGCATGGAATAAATTGCTTTATTAACAGGCAATTAATTTATAATTATCCTGAACAGCTCTTTGGTGCTGCTGGTGTCATGGCTATTGAGCATGCAGATTTTGCAGGTGTGGAACGCCTAGCTCTTGTCACAGGTGGTGAAATTGCCTCTACCTTTGATCACCCAGAACTGGTGAAGCTTGGAAGTTGCAAACTTATCGAGGAAGTCATGATTGGAGAAGACAAACTCATTCACTTTTCTGGGGTTGCCCTTGGTGAGGCTTGTACCATTGTTTTGCGTGGTGCCACTCAACAAATTTTAGATGAAGCAGAAAGATCATTGCATGATGCTCTTTGTGTTCTTGCGCAAACTGTAAAGGACTCTAGAACAGTTTATGGAGGAGGCTGTTCTGAGATGTTGATGGCTCATGCTGTGACACAGCTTGCCAATAGAACACCAGGCAAAGAAGCTGTTGCAATGGAGTCTTATGCTAAAGCACTGAGAATGTTGCCAACCATCATAGCTGACAATGCAGGCTATGACAGTGCAGACCTGGTGGCACAGCTCAGGGCTGCTCACAGTGAAGGCAATACCACTGCTGGATTGGGTAAGCAATCAAGGGGAACTTTGTGGCCGTTGTTAAAAGTAACTCTTTTCACTAAGCTTTTTTTTTCTTTTGGAACATAAAGAGTTACAATAACCGTATAAAAGACTCTTTTGGACTTTGTCCTCATAATCATTACATGTGCTGGGAAAATGTGTGTGACTTTATATGCTCAGCATTTCCCAAACTTTGTTATTCCATAAGACATGTAAAACTGGTTAGAAGATTTGTAACTATTTGGTATATAACGACTATA