Transcript asmbl_43260

Sequence
Transcript Sequence for observation asmbl_43260 of TGE0058641:
GGTCCCGAGCACGAGCTGTGAGGGGATTCACTTGTGTGCGGAACTCCTCGGAACCATGGCGTCCCTTTCCCTTGCACCTGTTAACATCTTTAAGGCAGGAGCTGATGAAGAGAGAGCAGAGACAGCTCGTCTGACTTCTTTTATTGGTGCCATCGCCATTGGAGACTTGGTAAAGAGCACCTTGGGACCCAAAGGCATGGACAAAATTCTTCTAAGCAGTGGACGAGATGCCTCTCTTATGGTAACCAATGATGGTGCCACTATTCTAAAAAACATTGGTGTTGACAATCCAGCAGCTAAAGTTTTAGTTGATATGTCAAGGGTTCAAGATGATGAAGTTGGTGATGGCACTACCTCTGTTACCGTTTTAGCAGCAGAATTATTAAGGGAAGCAGAATCTTTAATTGCAAAAAAGATTCATCCACAGACCATCATAGCGGGTTGGAGAGAAGCCACGAAGGCTGCAAGAGAGGCGCTGTTGAGTTCTGCAGTTGATCATGGTTCCGATGAAGTTAAATTCCGTCAAGATTTAATGAATATTGCGGGCACAACATTATCCTCAAAACTTCTTACTCATCACAAAGACCACTTTACAAAGTTAGCTGTAGAAGCAGTTCTCAGACTGAAAGGCTCTGGCAACCTGGAGGCAATTCATATTATCAAGAAGCTAGGAGGAAGTTTGGCAGATTCCTATTTAGATGAAGGCTTCCTGTTGGATAAAAAAATTGGAGTAAATCAACCAAAACGAATTGAAAATGCTAAAATTCTTATTGCAAATACTGGTATGGATACAGACAAAATAAAGATATTTGGTTCCCGGGTAAGAGTTGACTCTACAGCAAAGGTTGCAGAAATAGAACATGCGGAAAAGGAAAAAATGAAGGAGAAAGTTGAACGTATTCTTAAGCATGGAATAAATTGCTTTATTAACAGGCAATTAATTTATAATTATCCTGAACAGCTCTTTGGTGCTGCTGGTGTCATGGCTATTGAGCATGCAGATTTTGCAGGTGTGGAACGCCTAGCTCTTGTCACAGGTGGTGAAATTGCCTCTACCTTTGATCACCCAGAACTGGTGAAGCTTGGAAGTTGCAAACTTATCGAGGAAGTCATGATTGGAGAAGACAAACTCATTCACTTTTCTGGGGTTGCCCTTGGTGAGGCTTGTACCATTGTTTTGCGTGGTGCCACTCAACAAATTTTAGATGAAGCAGAAAGATCATTGCATGATGCTCTTTGTGTTCTTGCGCAAACTGTAAAGGACTCTAGAACAGTTTATGGAGGAGGCTGTTCTGAGATGTTGATGGCTCATGCTGTGACACAGCTTGCCAATAGAACACCAGGCAAAGAAGCTGTTGCAATGGAGTCTTATGCTAAAGCACTGAGAATGTTGCCAACCATCATAGCTGACAATGCAGGCTATGACAGTGCAGACCTGGTGGCACAGCTCAGGGCTGCTCACAGTGAAGGCAATACCACTGCTGGATTGGATATGAGGGAAGGCACCATTGGAGATATGGCTATCCTGGGTATAACAGAAAGTTTTCAAGTGAAGCGACAGGTTCTTCTGAGTGCAGCTGAAGCAGCAGAGGTGATTCTGCGTGTGGACAACATCATCAAAGCGGCACCCAGGAAACGTGTCCCTGATCACCACCCCTGTTAAGCATTCCCACGTGCTGTCGATCTTTGGACCAGTTTCTAGCAAAGTTGTGTTTGAAAGATACTCTATTAAAGAAGACTGTGGAATCTGTTTATCGGTGCCCATTATATCCTTAAGTTTGGATATTTAGCTGACCTTCGCTTTAACATAGGTCTAATTTATTTGCCGTGTCATTTTCCATACAAATCAGTTGATTTAAAAAAGTTCATTTCTCATACTGTGCATTAAAATAAAAATTTGAACAAT