Transcript asmbl_43107

Sequence
Transcript Sequence for observation asmbl_43107 of TGE0056781:
GAGTTTGTGGGTCAGAGTTTGTGGGTCAGAGTTTGTGGGGCTGGGATAGAAACTCGGGGGATTGGCGTTCAGATGCTGACCACTTCCCTCTTCTCTGAGCAGTGTGACTTCACCGAAGACCAGACCGCAGGTAGGTTATCTCTGATCCCTACCGAGGTCACCCTTAGGGAGAGGGACACCCTCCCCCCAGCACCTATCCTCTAATCTTAATCTGTCATCTCTTTAGCACCCCCATGAGATTACCCCCTGGATTATTTTCTCTTCTTCTGGATCCTCCATTTTCTTTTCTCACTTTCTTCCTCCCTCCCCTTCCACTCTAGATCTGATCCCAAGCACTGGGTGAGTTTTAGGTGGTGTGGGTATGTGAAAAAACTTGGTCACTTAATGCCTGCTGTGTGTGGGGTCTCGGGAGGGTGTATAAAGCTGCCTGCTTTCCTTTGTCCTTTAATCAGCTACTTCTGCCTCTTTTCTCCTCTTGTGATAACTGTCCCCGCCCTCCCAGCTTGCAGTTGTGAAGATTGTAGAGCAGTGACCTGATATTCTGTGCAGATGGGGACAAGACAGGGGAGTTTGCTAAGGATATGACTGTAGCTATACCCTCTGGAAGTTCTCTTTATACTGGAGGGGTGCGAAGTGGCAGGTTGGGATGACCCTAGTCCCAGGCTGCTGCTCCCACTTCCTTATAAGGACAGGACTGAGACTGGGCGGTGGCGAATTCCTGCCCTGAGAAGTGTAGTAGCAGCAGTGGAGATTGGCAGGCCTGCCGCAGGCAGAGGGGTTGTGTAAATGGATGTTACCAGGCTGCCAGAAGGGGAGGAAGCCTCTATATAGAACACTTGAGTTGGGAGGAAGAGAAATAGAGCCCTCTTAAGTAGACTTTGGTGTACAGTTTGGTGCAGATATCTCGTTTCCTCAGCATGATCAAAGTTGAATGGGCAGCAGAGCTCTGAGGTAGGGTTTGGATTAACCCTCAAATCCTGTGTTGACATTCATCTGAATCCTCAGAGTTCAAGGAGGCCTTCCAGCTGTTTGACCGAACAGGTGATGGCAAGATCCTGTACAGCCAGTGTGGGGATGTGATGAGGGCCCTGGGCCAGAACCCTACCAACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGCTGGACTTTGAGCACTTTCTGCCCATGCTGCAGACAGTGGCCAAGAACAAGGACCAGGGCACCTATGAGGATTATGTCGAAGGACTTCGGGTGTTTGACAAGGAAGGAAATGGCACCGTCATGGGTGCTGAAATCCGGCATGTTCTTGTCACACTGGGTGAGAAGATGACAGAGGAAGAAGTAGAGATGCTGGTGGCAGGGCATGAGGACAGCAATGGTTGTATCAACTATGAAGCGTTTGTGAGGCATATCCTGTCGGGGTGACGGGCCCATGGGGCGGGTACGGCTCCTCCCAGCCTCTCCTCTAGTTGATCTCCCCAGTGTTTCTTTTTTCCCCAACCTGTGCTCTTTATCCCCTGCCCTTACCCTACTACCATCTGACTTCCTCCTGGCATGTTTCTGCATGGAGCTGACTAGGGAGGGGAGGGATTCCTCAAAGAGGAAGACAACCTGGGGGTACAGTACCTCCTTACCTCTAGAATGGGCCCTGAGGTTTTACTTATGCGGCCCTGGGTGCTGGTGTCTGGGAACTCTCACCAGCCTGTATACCAGTCTTGCTTTAGGGTGACCTTCTGGCCCTGGAGCATGGGTAGCTGGCATAGAGGGGTATGGGTTGCCTGCCCCATTCTGCTGCTATAGCTGAACAGTCCTTTCCCCTTCCCTCGCTGGGCAGCTTGGAGGTACCCTAACCCAAAACTCTGTCCTCTCCTCCCGCCAGTGGCTGACAGTAGCTGTAGGTGTAGTGGAGAACTTTTCTGCCTCTGCTGTGTTCTTGCTGCTTAGGTTTGGGTGGGGGACTAACAGCTGCTGGGAGGGGAGCTAGGGGCATGGAGAACTGGTCAGACTCAAGGTGGCTCCTCTGCAAACTGACCCCAGGGTTGGTTGCTGTGGGCATGTTCCCGCTTATGCTACCTTTGCAGTCTGGTAGTCCCCTGGCCCTTGGCGTACCCCTCCACAGCCCTGTTCCCTGGCTCATCCCACCTTTCCTTTCCACAGAGCTCGTCCGCATGGTGCTGAATGGCTGAGGACCTTCCCAGTCTCCCCAGAGTCCGTGCCTTTCCCTGTGTGAATTTTGTATCTAGCCTAAAGTTTCCCTAGGCTTTCTTGTCTCAGCAACTTTCCCATCTTGTCTCTCTTGGATGATGTTTGCCGTCAGCATTCACCAAATAAACTTGCTCTCTGGGCCCTCGGTTCGGTTCTTTCTTTCCTGAACAGGGTAAAGGGGAAGAAGGTGAGATGGTGATGATTTCTGCCCTGAGGCAGAGTCCAAGGTCAATCAATGG