Transcript asmbl_43104

Sequence
Transcript Sequence for observation asmbl_43104 of TGE0056781:
GAGTTTGTGGGTCAGAGTTTGTGGGTCAGAGTTTGTGGGGCTGGGATAGAAACTCGGGGGATTGGCGTTCAGATGCTGACCACTTCCCTCTTCTCTGAGCAGTGTGACTTCACCGAAGACCAGACCGCAGGTAGGTTATCTCTGATCCCTACCGAGGTCACCCTTAGGGAGAGGGACACCCTCCCCCCAGCACCTATCCTCTAATCTTAATCTGTCATCTCTTTAGCACCCCCATGAGATTACCCCCTGGATTATTTTCTCTTCTTCTGGATCCTCCATTTTCTTTTCTCACTTTCTTCCTCCCTCCCCTTCCACTCTAGATCTGATCCCAAGCACTGGGTGAGTTTTAGGTGGTGTGGGTATGTGAAAAAACTTGGTCACTTAATGCCTGCTGTGTGTGGGGTCTCGGGAGGGTGTATAAAGCTGCCTGCTTTCCTTTGTCCTTTAATCAGCTACTTCTGCCTCTTTTCTCCTCTTGTGATAACTGTCCCCGCCCTCCCAGCTTGCAGTTGTGAAGATTGTAGAGCAGTGACCTGATATTCTGTGCAGATGGGGACAAGACAGGGGAGTTTGCTAAGGATATGACTGTAGCTATACCCTCTGGAAGTTCTCTTTATACTGGAGGGGTGCGAAGTGGCAGGTTGGGATGACCCTAGTCCCAGGCTGCTGCTCCCACTTCCTTATAAGGACAGGACTGAGACTGGGCGGTGGCGAATTCCTGCCCTGAGAAGTGTAGTAGCAGCAGTGGAGATTGGCAGGCCTGCCGCAGGCAGAGGGGTTGTGTAAATGGATGTTACCAGGCTGCCAGAAGGGGAGGAAGCCTCTATATAGAACACTTGAGTTGGGAGGAAGAGAAATAGAGCCCTCTTAAGTAGACTTTGGTGTACAGTTTGGTGCAGATATCTCGTTTCCTCAGCATGATCAAAGTTGAATGGGCAGCAGAGCTCTGAGGTAGGGTTTGGATTAACCCTCAAATCCTGTGTTGACATTCATCTGAATCCTCAGAGTTCAAGGAGGCCTTCCAGCTGTTTGACCGAACAGGTGATGGCAAGATCCTGTACAGCCAGTGTGGGGATGTGATGAGGGCCCTGGGCCAGAACCCTACCAACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGCTGGACTTTGAGCACTTTCTGCCCATGCTGCAGACAGTGGCCAAGAACAAGGACCAGGGCACCTATGAGGATTATGTCGAAGGACTTCGGGTGTTTGACAAGGAAGGAAATGGCACCGTCATGGGTGCTGAAATCCGGCATGTTCTTGTCACACTGGGTGAGAAGATGACAGAGGAAGAAGTAGAGATGCTGGTGGCAGGGCATGAGGACAGCAATGGTTGTATCAACTATGAAGCGTTTGTGAGGCATATCCTGTCGGGGTGACGGGCCCATGGGGCGGAGCTCGTCCGCATGGTGCTGAATGGCTGAGGACCTTCCCAGTCTCCCCAGAGTCCGTGCCTTTCCCTGTGTGAATTTTGTATCTAGCCTAAAGTTTCCCTAGGCTTTCTTGTCTCAGCAACTTTCCCATCTTGTCTCTCTTGGATGATGTTTGCCGTCAGCATTCACCAAATAAACTTGCTCTCTGGGCCCTCGGTTCGGTTCTTTCTTTCCTGAACAGGGTAAAGGGGAAGAAGGTGAGATGGTGATGATTTCTGCCCTGAGGCAGAGTCCAAGGTCAATCAATGG