Transcript asmbl_43103

Sequence
Transcript Sequence for observation asmbl_43103 of TGE0000264:
CCCCACCTCCGAGCGGGTTCTGTGCCCAGGTGGCGCTGGAGAAAGGAACAGCGGACCCCGCCCAAGTCATTACTAATGTAGCAATCGTCTGCATAAACCCAGGCCACGGTTCCTATTGGCTGAGTCCTCTGAGGGTGACGTCATCGGGACGTACTAAGACTAGGGTTGGGCCGAGAGTCGGAGCCATTACTGCAGGAAAAGGTCCCGGAGAGCTGAGCAGTCAAGATGTGTGACTTCACCGAAGACCAGACCGCAGAGTTCAAGGAGGCCTTCCAGCTGTTTGACCGAACAGGTGATGGCAAGATCCTGTACAGCCAGTGTGGGGATGTGATGAGGGCCCTGGGCCAGAACCCTACCAACGCCGAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGCTGGACTTTGAGCACTTTCTGCCCATGCTGCAGACAGTGGCCAAGAACAAGGACCAGGGCACCTATGAGGATTATGTCGAAGGACTTCGGGTGTTTGACAAGGAAGGAAATGGCACCGTCATGGGTGCTGAAATCCGGCATGTTCTTGTCACACTGGGTGAGAAGATGACAGAGGAAGAAGTAGAGATGCTGGTGGCAGGGCATGAGGACAGCAATGGTTGTATCAACTATGAAGCGTTTGTGAGGCATATCCTGTCGGGGTGACGGGCCCATGGGGCGGAGCTCGTCCGCATGGTGCTGAATGGCTGAGGACCTTCCCAGTCTCCCCAGAGTCCGTGCCTTTCCCTGTGTGAATTTTGTATCTAGCCTAAAGTTTCCCTAGGCTTTCTTGTCTCAGCAACTTTCCCATCTTGTCTCTCTTGGATGATGTTTGCCGTCAGCATTCACCAAATAAACTTGCTCTCTGGGCCCTCGGTTCGGTTCTTTCTTTCCTGAACAGGGTAAAGGGGAAGAAGGTGAGATGGTGATGATTTCTGCCCTGAGGCAGAGTCCAAGGTCAATCAATGG