Transcript asmbl_42902

Sequence
Transcript Sequence for observation asmbl_42902 of TGE0056192:
TCCACACCTGTCTGTACCCCTGTCTCTCCTTTCCCTGGCTCTGCCAGACTCTCTATCTCCCTGGGCGCCAGCCTCCCCACCCACCCCTGGAGGGCGGGGCTTGGCTGCACCCACGTGTGGTGGAGTTAAATGCTCCTAGCCGGCAGAGGAGCTAGGGAGTGTGGCACTGAGCCGGCTCAGGCAGAGACGCGGCACCATGGCTAGCAAGAAAGTCTGCATTGTAGGCTCCGGGAACTGGGGCTCAGCCATCGCCAAGATCGTGGGTGGCAATGCAGCCCAGCTGGCACAGTTTGACCCACGGGTGACCATGTGGGTATTTGAGGAAGACATTGGAGGCAAAAAGCTGACTGAGATCATCAACACGCAGCATGAGAATGTCAAATACCTGCCAGGGCACAAGTTGCCCCCAAATGTGGTGGCTGTCCCAGATGTGGTCCAGGCTGCAGAGGATGCTGACATCCTGATCTTTGTGGTGCCCCATCAGTTCATCGGCAAGATCTGTGACCAGCTCAAGGGCCATCTGAAGGCAAACGCCACTGGCATATCTCTTATTAAGGGGGTAGACGAGGGCCCCAATGGGCTGAAGCTCATCTCGGAAGTGATTGGGGAGCGCCTCGGCATCCCCATGAGTGTGCTGATGGGGGCCAACATTGCCAGCGAGGTGGCTGATGAGAAGTTCTGTGAGACAACCATTGGCTGCAAGGACCCGGCCCAGGGACAACTCCTGAAAGAGCTGATGCAGACACCAAACTTCCGTATCACAGTGGTGCAAGAGGTGGACACAGTAGAGATCTGTGGAGCCTTAAAGAATGTAGTGGCCGTGGGGGCTGGCTTCTGTGATGGCCTGGGCTTTGGCGACAACACCAAGGCGGCAGTGATCCGGCTGGGACTCATGGAGATGATAGCCTTCGCCAAGCTCTTCTGCAGTGGCCCTGTGTCCTCTGCCACCTTCTTGGAGAGCTGTGGTGTTGCTGACCTGATCACTACCTGCTATGGAGGGCGGAACCGGAAAGTGGCTGAGGCCTTTGCGCGTACAGGAAAGTCCATTGAGCAGCTGGAGAAAGAGTTGCTGAATGGGCAGAAACTGCAGGGGCCCGAGACAGCCCGGGAGCTATACAGCATCCTCCAGCACAAGGGCCTGGTAGACAAGTTTCCCTTGTTCATGGCTGTGTACAAGGTGTGCTACGAGGGCCAGCCAGTGGGTGAATTCATCCACTGCCTGCAGAATCATCCAGAACATATGTGAGTGGGGCCAGGGCCCAGGCCAGGCCGCTTTTTTACCCCAGTGGAGACCAGCAGAAGCCTGGGGTACCTAGTCACCAGGATCTCCAGGACTCCCAGGGAGCAGAGTCTTCTCATCTTTTCACTGGAGGACAGGAGGCTATGGGGCCCAGCTACGCACCTGGAGATCCTGAACTGTCAAGCCACTGGCAGCCTCATGCCACCACATTTGCCAGAAATGCAGTTGCCCTGTCCCTCTCCAGATGTGGGGCTTTCTCCATATCCTCTGGGAGGGGTGGAATCAAGCCCCAGTGCTGCCTGCTTGGTGGCGGGGGTGATGTATGTGGAGAAGGGTTGGGGGAGAGGCCGGTAGGGCAGGGGCTGCTAGTGGCTGTCTCACATACACCAGTAATCCTGTTAAAGGGCTGAAGAAGTATCTTAGCCACAGGAGCGATGAGGCAAGGATTGTCAGGGAGGGGTCTGGGCTTCTGAGCTGATGCAGGCCCCAAGGACCCCTTTGCTGACCTCTGCCAGGACCCACACAGCTTCGATGGATCTCAGTGTTTGTTAACAAAATACAAAGATCTCAAACAAACCCCTTTTAGCTTCTCCTAGCAACATCTGTGTCCTCAGAAACCTCTGGTTCTCCCCCTTCCCCCTCCCCCAGGCTGCCCTGGCACCCAAATTGCTGCCATGCTGGCATCTGTAGCTCGGTGGCTTGACATTCTCCCCAGGGACTTCCCGGTTCCTAGTTCTTTGCCAGCTCCTCCCCACTCTGTGCGACCTTTCCAAGCCTTCCCTCACCCTCCCCGCCAGCACCCTCTTTGGGGAGCAGGAACTTAATCTGCTGACAGAGCTACACCTTTCATAACAGGCTCAGATCACTCAGCTCCCTGTGACCTTTGTATTCACCCAGGCTTCCTTCTCAGTAGCTCTAGCTGGGGGAGGTGTCAGCTGGGCCCCTCCTGTGCTATCTCCCCAGAGGACATCCCTGACTCCACCCCTTTCTTCCTCCCAAACTCTGCACCTCTTCCTCAGCTGCTCCAGACCGGCCAGGGTAACCAGCTAACCATGCCTGGCATCTGGAAGCCAGCAGGCCAGAGGGTGGCCCAAAGGCTGATGAACGGTAGGGAAGGGTGAGCAGATTCCTATGTTGGTGGGCACCAATATTCCAAGGGCAGCTCTCTTTGCTGAATGAGGGCCTTCTCGTGAGGTACTGACAACACCAGCAACTCGAGAGCTGGGAAACTCAAGGAGGAGGAAGAAAATCAAAACCACCCTACTCCCTGGGGTGAGGAAAGAACAGGAGGGGAGGAGGAGGAGTGTGCTCTGCACTTGCCTTGCTCCAGGATGGGGTGGCAGCAGAGGAATGTCACAGGTCAGCAGCCTAGGCCTCCAGCTATAAATAGTCCGGAGGGCCCGAGAGGCTCCCGCCCGTCCAGCAGGGCTGTCAGCTTCCTGTGTGGCAGCACCTGGCACACTGGCTCTGGCCAGCATTATGCTAAAACCCTGTTACTCTCCAATGAACCAGGGAGGCGGGCTCCTCTCTGCGCCTATCCCTTGAGAATTCTGTCTTACCAGTGAAGGGTGGGGCTGCCCAGATCAGGCAGCAGGAGTGAGGGGCACAGTCACCCCAGGCCTTGCTGAGCCCAGGTCTGGGTACTGAGTGTCCAGAGCTGCCTCCCCAGGAGGTTAAGGTGGGGGCAAAGGGGAAGCTTCAAGCACTTTGCCTACTTTTGTTCACTCCCCAGTGCACTGTGACTCAGGCCTTCCCATCAGGCCTATTTGTCTACCCAATAAAGCGTGTTTTTTCCAGAAACAAGAAGAGTTGGGAGAGGGAGCTTCAGTGCATGTGGCAGTGCGTGTGCTGGCGCGTATCATTGCACGTATGTTTTCCCTCTTACCGTAGGAAAAATGAAAAAAGAAATCCCTCCTCCATAATCGCAGCTACTCCAGGGGTCAGCGGCGGTGCCCACTCAGTCCCCATCCCTCTCTCTCCCCTCCCGCCAGCGCCCCCTCCCGCCCTCGCCGCAAGCTGGCCCCGGCCTTGCCGGCCCTTCTTAGGGGCTTTATCATGCCTCCTGCAAGAATAGAGATCACACACGGGACGGAAACGTTAGACTCTCATCCCTTGTGCCCATTCCTTGGTCACGGGCCAAGCTGCCGCATCCTTAGCGGTCCAGGCATCGCGGTGCCCCTCGGGCCCCTACCTGGACTAGGCCCACAGCCGGGCTCTAGGGGGCGCGCGATCCACCTCCAGAAGGCCGGCTGCGAAAATCTACCCAGCTACTGGCGACGTCACCGCACCGTAGGCTGAGGATTGGCTGACTCTGATTTAGCATCCTAAAACTTCCGGTTCCAGAGCTTGGCTCGCCAAAGACCCTCCCTCGAGGGAGAGAAACCACAGCCCCCAGAATTCAGCGGGCCTCTCCGAGAGCACGGCGCGTCTGAGGATGCGTAGTAAGGATAACGGGCCCGGAAGCCGGAAGTTCAAAGCCGGCCTCCAGCCAGAGTGACGGCCTGCGCGGACTCCCGCCTTAGTGGGCGGAGTTGTGCCGCGTCTGATGCGCAGTTCCCTTTATAGCGCGGCAAGCCGAATCCTAGAGGCTAACCCGGCAGGTGGGAGGGAGAAAGTTGCTTTCTGCACCAATAGCTGAGGCGTTCAGGGTTGTCCAGGGACGCTACCCTCACGTGTCTGGTTCCGAGTGCTGCGTTCGGCTGTGCTGGGAAGTTGCGTAGACAGTGGCCTCGAGACCCTGCCTGCCTGAGGAGGCCTCGGTTGGATGCGAAGGAGCTGCAGCATCCAGAGACTATGGAAGAGAGTACCTGGATCTAGTTTATTCCAAAGACAGACAAGCAGTTTGTGCCTCCACTCCAGGATGACTAACTACAACGATTACACGTAAAAAGACAAAACAAGGCCGGGCGCGGCGGTTCACGCTTGTAATCCCAGCACTT