Transcript asmbl_42901

Sequence
Transcript Sequence for observation asmbl_42901 of TGE0056192:
TCCACACCTGTCTGTACCCCTGTCTCTCCTTTCCCTGGCTCTGCCAGACTCTCTATCTCCCTGGGCGCCAGCCTCCCCACCCACCCCTGGAGGGCGGGGCTTGGCTGCACCCACGTGTGGTGGAGTTAAATGCTCCTAGCCGGCAGAGGAGCTAGGGAGTGTGGCACTGAGCCGGCTCAGGCAGAGACGCGGCACCATGGCTAGCAAGAAAGTCTGCATTGTAGGCTCCGGGAACTGGGGCTCAGCCATCGCCAAGATCGTGGGTGGCAATGCAGCCCAGCTGGCACAGTTTGACCCACGGGTGACCATGTGGGTATTTGAGGAAGACATTGGAGGCAAAAAGCTGACTGAGATCATCAACACGCAGCATGAGAATGTCAAATACCTGCCAGGGCACAAGTTGCCCCCAAATGTGGTGGCTGTCCCAGATGTGGTCCAGGCTGCAGAGGATGCTGACATCCTGATCTTTGTGGTGCCCCATCAGTTCATCGGCAAGATCTGTGACCAGCTCAAGGGCCATCTGAAGGCAAACGCCACTGGCATATCTCTTATTAAGGGGGTAGACGAGGGCCCCAATGGGCTGAAGCTCATCTCGGAAGTGATTGGGGAGCGCCTCGGCATCCCCATGAGTGTGCTGATGGGGGCCAACATTGCCAGCGAGGTGGCTGATGAGAAGTTCTGTGAGACAACCATTGGCTGCAAGGACCCGGCCCAGGGACAACTCCTGAAAGAGCTGATGCAGACACCAAACTTCCGTATCACAGTGGTGCAAGAGGTGGACACAGTAGAGATCTGTGGAGCCTTAAAGAATGTAGTGGCCGTGGGGGCTGGCTTCTGTGATGGCCTGGGCTTTGGCGACAACACCAAGGCGGCAGTGATCCGGCTGGGACTCATGGAGATGATAGCCTTCGCCAAGCTCTTCTGCAGTGGCCCTGTGTCCTCTGCCACCTTCTTGGAGAGCTGTGGTGTTGCTGACCTGATCACTACCTGCTATGGAGGGCGGAACCGGAAAGTGGCTGAGGCCTTTGCGCGTACAGGAAAGTCCATTGAGCAGCTGGAGAAAGAGTTGCTGAATGGGCAGAAACTGCAGGGGCCCGAGACAGCCCGGGAGCTATACAGCATCCTCCAGCACAAGGGCCTGGTAGACAAGTTTCCCTTGTTCATGGCTGTGTACAAGGTGTGCTACGAGGGCCAGCCAGTGGGTGAATTCATCCACTGCCTGCAGAATCATCCAGAACATATGTGAGTGGGGCCAGGGCCCAGGCCAGGCCGCTTTTTTACCCCAGTGGAGACCAGCAGAAGCCTGGGGTACCTAGTCACCAGGATCTCCAGGACTCCCAGGGAGCAGAGTCTTCTCATCTTTTCACTGGAGGACAGGAGGCTATGGGGCCCAGCTACGCACCTGGAGATCCTGAACTGTCAAGCCACTGGCAGCCTCATGCCACCACATTTGCCAGAAATGCAGTTGCCCTGTCCCTCTCCAGATGTGGGGCTTTCTCCATATCCTCTGGGAGGGGTGGAATCAAGCCCCAGTGCTGCCTGCTTGGTGGCGGGGGTGATGTATGTGGAGAAGGGTTGGGGGAGAGGCCGGTAGGGCAGGGGCTGCTAGTGGCTGTCTCACATACACCAGTAATCCTGTTAAAGGGCTGAAGAAGTATCTTAGCCACAGGAGCGATGAGGCAAGGATTGTCAGGGAGGGGTCTGGGCTTCTGAGCTGATGCAGGCCCCAAGGACCCCTTTGCTGACCTCTGCCAGGACCCACACAGCTTCGATGGATCTCAGTGTTTGTTAACAAAATACAAAGATCTCAAACAAACCCCTTTTAGCTTCTCCTAGCAACATCTGTGTCCTCAGAAACCTCTGGTTCTCCCCCTTCCCCCTCCCCCAGGCTGCCCTGGCACCCAAATTGCTGCCATGCTGGCATCTGTAGCTCGGTGGCTTGACATTCTCCCCAGGGACTTCCCGGTTCCTAGTTCTTTGCCAGCTCCTCCCCACTCTGTGCGACCTTTCCAAGCCTTCCCTCACCCTCCCCGCCAGCACCCTCTTTGGGGAGCAGGAACTTAATCTGCTGACAGAGCTACACCTTTCATAACAGGCTCAGATCACTCAGCTCCCTGTGACCTTTGTATTCACCCAGGCTTCCTTCTCAGTAGCTCTAGCTGGGGGAGGTGTCAGCTGGGCCCCTCCTGTGCTATCTCCCCAGAGGACATCCCTGACTCCACCCCTTTCTTCCTCCCAAACTCTGCACCTCTTCCTCAGCTGCTCCAGACCGGCCAGGGTAACCAGCTAACCATGCCTGGCATCTGGAAGCCAGCAGGCCAGAGGGTGGCCCAAAGGCTGATGAACGGTAGGGAAGGGTGAGCAGATTCCTATGTTGGTGGGCACCAATATTCCAAGGGCAGCTCTCTTTGCTGAATGAGGGCCTTCTCGTGAGGTACTGACAACACCAGCAACTCGAGAGCTGGGAAACTCAAGGAGGAGGAAGAAAATCAAAACCACCCTACTCCCTGGGGTGAGGAAAGAACAGGAGGGGAGGAGGAGGAGTGTGCTCTGCACTTGCCTTGCTCCAGGATGGGGTGGCAGCAGAGGAATGTCACAGGTCAGCAGCCTAGGCCTCCAGCTATAAATAGTCCGGAGGGCCCGAGAGGCTCCCGCCCGTCCAGCAGGGCTGTCAGCTTCCTGTGTGGCAGCACCTGGCACACTGGCTCTGGCCAGCATTATGCTAAAACCCTGTTACTCTCCAATGAACCAGGGAGGCGGGCTCCTCTCTGCGCCTATCCCTTGAGAATTCTGTCTTACCAGTGAAGGGTGGGGCTGCCCAGATCAGGCAGCAGGAGTGAGGGGCACAGTCACCCCAGGCCTTGCTGAGCCCAGGTCTGGGTACTGAGTGTCCAGAGCTGCCTCCCCAGGAGGTTAAGGTGGGGGCAAAGGGGAAGCTTCAAGCACTTTGCCTACTTTTGTTCACTCCCCAGTGCACTGTGACTCAGGCCTTCCCATCAGGCCTATTTGTCTACCCAATAAAGCGTGTTTTTTCCAGAAACAAGAAGAGTTGGGAGAGGGAGCTTCAGTGCATGTGGCAGTGCGTGTGCTGGCGCGTATCATTGCACGTATGTTTTCCCTCTTACCGTAGGAAAAATGAAAAAAGAAATCCCTCCTCCATAATCGCAGCTACTCCAGGGGTCAGCGGCGGTGCCCACTCAGTCCCCATCCCTCTCTCTCCCCTCCCGCCAGCGCCCCCTCCCGCCCTCGCCGCAAGCTGGCCCCGGCCTTGCCGGCCCTTCTTAGGGGCTTTATCATGCCTCCTGCAAGAATAGAGATCACACACGGGACGGAAACGTTAGACTCTCATCCCTTGTGCCCATTCCTTGGTCACGGGCCAAGCTGCCGCATCCTTAGCGGTCCAGGCATCGCGGTGCCCCTCGGGCCCCTACCTGGACTAGGCCCACAGCCGGGCTCTAGGGGGCGCGCGATCCACCTCCAGAAGGCCGGCTGCGAAAATCTACCCAGCTACTGGCGACGTCACCGCACCGTAGGCTGAGGATTGGCTGACTCTGATTTAGCATCCTAAAACTTCCGGTTCCAGAGCTTGGCTCGCCAAAGACCCTCCCTCGAGGGAGAGAAACCACAGCCCCCAGAATTCAGCGGGCCTCTCCGAGAGCACGGCGCGTCTGAGGATGCGTAGTAAGGATAACGGGCCCGGAAGCCGGAAGTTCAAAGCCGGCCTCCAGCCAGAGTGACGGCCTGCGCGGACTCCCGCCTTAGTGGGCGGAGTTGTGCCGCGTCTGATGCGCAGTTCCCTTTATAGCGCGGCAAGCCGAATCCTAGAGGCTAACCCGGCAGGTGGGAGGGAGAAAGTTGCTTTCTGCACCAATAGCTGAGGCGTTCAGGGTTGTCCAGGGACGCTACCCTCACGTGTCTGGTTCCGAGTGCTGCGTTCGGCTGTGCTGGGAAGTTGCGTAGACAGTGGCCTCGAGACCCTGCCTGCCTGAGGAGGCCTCGGTTGGATGCGAAGGAGCTGCAGCATCCAGGGGACAAGATGCCAACTGGCAAGCAGCTAGCTGACATTGGCTATAAGACCTTCTCTACCTCCATGATGCTTCTCACTGTGTATGGGGGGTACCTCTGCAGTGTCCGAGTCTACCACTATTTCCAGTGGCGCAGGGCCCAGCGCCAGGCCGCAGAAGAACAGAAGACCTCAGGAATCATGTAGAACTGGGGGGCTTTTTCTCCTGAGCAGAGAGGCCCAAGGCATGCTGTGGAGAGACTTCACCTGCCACCATTTCCAGGTCAACAGGACTAGAGCGTTGATGGTTTTCAAACCCTGTTGGAAGAAAGTGCCCATGGTTTCTCTGGTTCTGCCAGTTTGACAGTTTATGGAGGCTTTTGAATCGTAATAGCAATGTGAGGGTGAGGTACACCTACAGACATTAAATAATTTGCTGTG