Transcript asmbl_42900

Sequence
Transcript Sequence for observation asmbl_42900 of TGE0056192:
TCCACACCTGTCTGTACCCCTGTCTCTCCTTTCCCTGGCTCTGCCAGACTCTCTATCTCCCTGGGCGCCAGCCTCCCCACCCACCCCTGGAGGGCGGGGCTTGGCTGCACCCACGTGTGGTGGAGTTAAATGCTCCTAGCCGGCAGAGGAGCTAGGGAGTGTGGCACTGAGCCGGCTCAGGCAGAGACGCGGCACCATGGCTAGCAAGAAAGTCTGCATTGTAGGCTCCGGGAACTGGGGCTCAGCCATCGCCAAGATCGTGGGTGGCAATGCAGCCCAGCTGGCACAGTTTGACCCACGGGTGACCATGTGGGTATTTGAGGAAGACATTGGAGGCAAAAAGCTGACTGAGATCATCAACACGCAGCATGAGAATGTCAAATACCTGCCAGGGCACAAGTTGCCCCCAAATGTGGTGGCTGTCCCAGATGTGGTCCAGGCTGCAGAGGATGCTGACATCCTGATCTTTGTGGTGCCCCATCAGTTCATCGGCAAGATCTGTGACCAGCTCAAGGGCCATCTGAAGGCAAACGCCACTGGCATATCTCTTATTAAGGGGGTAGACGAGGGCCCCAATGGGCTGAAGCTCATCTCGGAAGTGATTGGGGAGCGCCTCGGCATCCCCATGAGTGTGCTGATGGGGGCCAACATTGCCAGCGAGGTGGCTGATGAGAAGTTCTGTGAGACAACCATTGGCTGCAAGGACCCGGCCCAGGGACAACTCCTGAAAGAGCTGATGCAGACACCAAACTTCCGTATCACAGTGGTGCAAGAGGTGGACACAGTAGAGATCTGTGGAGCCTTAAAGAATGTAGTGGCCGTGGGGGCTGGCTTCTGTGATGGCCTGGGCTTTGGCGACAACACCAAGGCGGCAGTGATCCGGCTGGGACTCATGGAGATGATAGCCTTCGCCAAGCTCTTCTGCAGTGGCCCTGTGTCCTCTGCCACCTTCTTGGAGAGCTGTGGTGTTGCTGACCTGATCACTACCTGCTATGGAGGGCGGAACCGGAAAGTGGCTGAGGCCTTTGCGCGTACAGGAAAGTCCATTGAGCAGCTGGAGAAAGAGTTGCTGAATGGGCAGAAACTGCAGGGGCCCGAGACAGCCCGGGAGCTATACAGCATCCTCCAGCACAAGGGCCTGGTAGACAAGTTTCCCTTGTTCATGGCTGTGTACAAGGTGTGCTACGAGGGCCAGCCAGTGGGTGAATTCATCCACTGCCTGCAGAATCATCCAGAACATATGTGAGTGGGGCCAGGGCCCAGGCCAGGCCGCTTTTTTACCCCAGTGGAGACCAGCAGAAGCCTGGGGTACCTAGTCACCAGGATCTCCAGGACTCCCAGGGAGCAGAGTCTTCTCATCTTTTCACTGGAGGACAGGAGGCTATGGGGCCCAGCTACGCACCTGGAGATCCTGAACTGTCAAGCCACTGGCAGCCTCATGCCACCACATTTGCCAGAAATGCAGTTGCCCTGTCCCTCTCCAGATGTGGGGCTTTCTCCATATCCTCTGGGAGGGGTGGAATCAAGCCCCAGTGCTGCCTGCTTGGTGGCGGGGGTGATGTATGTGGAGAAGGGTTGGGGGAGAGGCCGGTAGGGCAGGGGCTGCTAGTGGCTGTCTCACATACACCAGTAATCCTGTTAAAGGGCTGAAGAAGTATCTTAGCCACAGGAGCGATGAGGCAAGGATTGTCAGGGAGGGGTCTGGGCTTCTGAGCTGATGCAGGCCCCAAGGACCCCTTTGCTGACCTCTGCCAGGACCCACACAGCTTCGATGGATCTCAGTGTTTGTTAACAAAATACAAAGATCTCAAACAAACCCCTTTTAGCTTCTCCTAGCAACATCTGTGTCCTCAGAAACCTCTGGTTCTCCCCCTTCCCCCTCCCCCAGGCTGCCCTGGCACCCAAATTGCTGCCATGCTGGCATCTGTAGCTCGGTGGCTTGACATTCTCCCCAGGGACTTCCCGGTTCCTAGTTCTTTGCCAGCTCCTCCCCACTCTGTGCGACCTTTCCAAGCCTTCCCTCACCCTCCCCGCCAGCACCCTCTTTGGGGAGCAGGAACTTAATCTGCTGACAGAGCTACACCTTTCATAACAGGCTCAGATCACTCAGCTCCCTGTGACCTTTGTATTCACCCAGGCTTCCTTCTCAGTAGCTCTAGCTGGGGGAGGTGTCAGCTGGGCCCCTCCTGTGCTATCTCCCCAGAGGACATCCCTGACTCCACCCCTTTCTTCCTCCCAAACTCTGCACCTCTTCCTCAGCTGCTCCAGACCGGCCAGGGTAACCAGCTAACCATGCCTGGCATCTGGAAGCCAGCAGGCCAGAGGGTGGCCCAAAGGCTGATGAACGGTAGGGAAGGGTGAGCAGATTCCTATGTTGGTGGGCACCAATATTCCAAGGGCAGCTCTCTTTGCTGAATGAGGGCCTTCTCGTGAGGTACTGACAACACCAGCAACTCGAGAGCTGGGAAACTCAAGGAGGAGGAAGAAAATCAAAACCACCCTACTCCCTGGGGTGAGGAAAGAACAGGAGGGGAGGAGGAGGAGTGTGCTCTGCACTTGCCTTGCTCCAGGATGGGGTGGCAGCAGAGGAATGTCACAGGTCAGCAGCCTAGGCCTCCAGCTATAAATAGTCCGGAGGGCCCGAGAGGCTCCCGCCCGTCCAGCAGGGCTGTCAGCTTCCTGTGTGGCAGCACCTGGCACACTGGCTCTGGCCAGCATTATGCTAAAACCCTGTTACTCTCCAATGAACCAGGGAGGCGGGCTCCTCTCTGCGCCTATCCCTTGAGAATTCTGTCTTACCAGTGAAGGGTGGGGCTGCCCAGATCAGGCAGCAGGAGTGAGGGGCACAGTCACCCCAGGCCTTGCTGAGCCCAGGTCTGGGTACTGAGTGTCCAGAGCTGCCTCCCCAGGAGGTTAAGGTGGGGGCAAAGGGGAAGCTTCAAGCACTTTGCCTACTTTTGTTCACTCCCCAGTGCACTGTGACTCAGGCCTTCCCATCAGGCCTATTTGTCTACCCAATAAAGCGTGTTTTTTCCAGAAACAAGAAGAGTTGGGAGAGGGAGCTTCAGTGCATGTGGCAGTGCGTGTGCTGGCGCGTATCATTGCACCGCCCCCTCCCGCCCTCGCCGCAAGCTGGCCCCGGCCTTGCCGGCCCTTCTTAGGGGCTTTATCATGCCTCCTGCAAGAATAGAGATCACACACGGGACGGAAACGTTAGACTCTCATCCCTTGTGCCCATTCCTTGGTCACGGGCCAAGCTGCCGCATCCTTAGCGGTCCAGGCATCGCGGTGCCCCTCGGGCCCCTACCTGGACTAGGCCCACAGCCGGGCTCTAGGGGGCGCGCGATCCACCTCCAGAAGGCCGGCTGCGAAAATCTACCCAGCTACTGGCGACGTCACCGCACCGTAGGCTGAGGATTGGCTGACTCTGATTTAGCATCCTAAAACTTCCGGTTCCAGAGCTTGGCTCGCCAAAGACCCTCCCTCGAGGGAGAGAAACCACAGCCCCCAGAATTCAGCGGGCCTCTCCGAGAGCACGGCGCGTCTGAGGATGCGTAGTAAGGATAACGGGCCCGGAAGCCGGAAGTTCAAAGCCGGCCTCCAGCCAGAGTGACGGCCTGCGCGGACTCCCGCCTTAGTGGGCGGAGTTGTGCCGCGTCTGATGCGCAGTTCCCTTTATAGCGCGGCAAGCCGAATCCTAGAGGCTAACCCGGCAGGTGGGAGGGAGAAAGTTGCTTTCTGCACCAATAGCTGAGGCGTTCAGGGTTGTCCAGGGACGCTACCCTCACGTGTCTGGTTCCGAGTGCTGCGTTCGGCTGTGCTGGGAAGTTGCGTAGACAGTGGCCTCGAGACCCTGCCTGCCTGAGGAGGCCTCGGTTGGATGCGAAGGAGCTGCAGCATCCAGGGGACAAGATGCCAACTGGCAAGCAGCTAGCTGACATTGGCTATAAGACCTTCTCTACCTCCATGATGCTTCTCACTGTGTATGGGGGGTACCTCTGCAGTGTCCGAGTCTACCACTATTTCCAGTGGCGCAGGGCCCAGCGCCAGGCCGCAGAAGAACAGAAGACCTCAGGAATCATGTAGAACTGGGGGGCTTTTTCTCCTGAGCAGAGAGGCCCAAGGCATGCTGTGGAGAGACTTCACCTGCCACCATTTCCAGGTCAACAGGACTAGAGCGTTGATGGTTTTCAAACCCTGTTGGAAGAAAGTGCCCATGGTTTCTCTGGTTCTGCCAGTTTGACAGTTTATGGAGGCTTTTGAATCGTAATAGCAATGTGAGGGTGAGGTACACCTACAGACATTAAATAATTTGCTGTG