Transcript asmbl_42899

Sequence
Transcript Sequence for observation asmbl_42899 of TGE0056192:
TCCACACCTGTCTGTACCCCTGTCTCTCCTTTCCCTGGCTCTGCCAGACTCTCTATCTCCCTGGGCGCCAGCCTCCCCACCCACCCCTGGAGGGCGGGGCTTGGCTGCACCCACGTGTGGTGGAGTTAAATGCTCCTAGCCGGCAGAGGAGCTAGGGAGTGTGGCACTGAGCCGGCTCAGGCAGAGACGCGGCACCATGGCTAGCAAGAAAGTCTGCATTGTAGGCTCCGGGAACTGGGGCTCAGCCATCGCCAAGATCGTGGGTGGCAATGCAGCCCAGCTGGCACAGTTTGACCCACGGGTGACCATGTGGGTATTTGAGGAAGACATTGGAGGCAAAAAGCTGACTGAGATCATCAACACGCAGCATGAGAATGTCAAATACCTGCCAGGGCACAAGTTGCCCCCAAATGTGGTGGCTGTCCCAGATGTGGTCCAGGCTGCAGAGGATGCTGACATCCTGATCTTTGTGGTGCCCCATCAGTTCATCGGCAAGATCTGTGACCAGCTCAAGGGCCATCTGAAGGCAAACGCCACTGGCATATCTCTTATTAAGGGGGTAGACGAGGGCCCCAATGGGCTGAAGCTCATCTCGGAAGTGATTGGGGAGCGCCTCGGCATCCCCATGAGTGTGCTGATGGGGGCCAACATTGCCAGCGAGGTGGCTGATGAGAAGTTCTGTGAGACAACCATTGGCTGCAAGGACCCGGCCCAGGGACAACTCCTGAAAGAGCTGATGCAGACACCAAACTTCCGTATCACAGTGGTGCAAGAGGTGGACACAGTAGAGATCTGTGGAGCCTTAAAGAATGTAGTGGCCGTGGGGGCTGGCTTCTGTGATGGCCTGGGCTTTGGCGACAACACCAAGGCGGCAGTGATCCGGCTGGGACTCATGGAGATGATAGCCTTCGCCAAGCTCTTCTGCAGTGGCCCTGTGTCCTCTGCCACCTTCTTGGAGAGCTGTGGTGTTGCTGACCTGATCACTACCTGCTATGGAGGGCGGAACCGGAAAGTGGCTGAGGCCTTTGCGCGTACAGGAAAGTCCATTGAGCAGCTGGAGAAAGAGTTGCTGAATGGGCAGAAACTGCAGGGGCCCGAGACAGCCCGGGAGCTATACAGCATCCTCCAGCACAAGGGCCTGGTAGACAAGTTTCCCTTGTTCATGGCTGTGTACAAGGTGTGCTACGAGGGCCAGCCAGTGGGTGAATTCATCCACTGCCTGCAGAATCATCCAGAACATATGTGAGTGGGGCCAGGGCCCAGGCCAGGCCGCTTTTTTACCCCAGTGGAGACCAGCAGAAGCCTGGGGTACCTAGTCACCAGGATCTCCAGGACTCCCAGGGAGCAGAGTCTTCTCATCTTTTCACTGGAGGACAGGAGGCTATGGGGCCCAGCTACGCACCTGGAGATCCTGAACTGTCAAGCCACTGGCAGCCTCATGCCACCACATTTGCCAGAAATGCAGTTGCCCTGTCCCTCTCCAGATGTGGGGCTTTCTCCATATCCTCTGGGAGGGGTGGAATCAAGCCCCAGTGCTGCCTGCTTGGTGGCGGGGGTGATGTATGTGGAGAAGGGTTGGGGGAGAGGCCGGTAGGGCAGGGGCTGCTAGTGGCTGTCTCACATACACCAGTAATCCTGTTAAAGGGCTGAAGAAGTATCTTAGCCACAGGAGCGATGAGGCAAGGATTGTCAGGGAGGGGTCTGGGCTTCTGAGCTGATGCAGGCCCCAAGGACCCCTTTGCTGACCTCTGCCAGGACCCACACAGCTTCGATGGATCTCAGTGTTTGTTAACAAAATACAAAGATCTCAAACAAACCCCTTTTAGCTTCTCCTAGCAACATCTGTGTCCTCAGAAACCTCTGGTTCTCCCCCTTCCCCCTCCCCCAGGCTGCCCTGGCACCCAAATTGCTGCCATGCTGGCATCTGTAGCTCGGTGGCTTGACATTCTCCCCAGGGACTTCCCGGTTCCTAGTTCTTTGCCAGCTCCTCCCCACTCTGTGCGACCTTTCCAAGCCTTCCCTCACCCTCCCCGCCAGCACCCTCTTTGGGGAGCAGGAACTTAATCTGCTGACAGAGCTACACCTTTCATAACAGGCTCAGATCACTCAGCTCCCTGTGACCTTTGTATTCACCCAGGCTTCCTTCTCAGTAGCTCTAGCTGGGGGAGGTGTCAGCTGGGCCCCTCCTGTGCTATCTCCCCAGAGGACATCCCTGACTCCACCCCTTTCTTCCTCCCAAACTCTGCACCTCTTCCTCAGCTGCTCCAGACCGGCCAGGGTAACCAGCTAACCATGCCTGGCATCTGGAAGCCAGCAGGCCAGAGGGTGGCCCAAAGGCTGATGAACGGTAGGGAAGGGTGAGCAGATTCCTATGTTGGTGGGCACCAATATTCCAAGGGCAGCTCTCTTTGCTGAATGAGGGCCTTCTCGTGAGGTACTGACAACACCAGCAACTCGAGAGCTGGGAAACTCAAGGAGGAGGAAGAAAATCAAAACCACCCTACTCCCTGGGGTGAGGAAAGAACAGGAGGGGAGGAGGAGGAGTGTGCTCTGCACTTGCCTTGCTCCAGGATGGGGTGGCAGCAGAGGAATGTCACAGGTCAGCAGCCTAGGCCTCCAGCTATAAATAGTCCGGAGGGCCCGAGAGGCTCCCGCCCGTCCAGCAGGGCTGTCAGCTTCCTGTGTGGCAGCACCTGGCACACTGGCTCTGGCCAGCATTATGCTAAAACCCTGTTACTCTCCAATGAACCAGGGAGGCGGGCTCCTCTCTGCGCCTATCCCTTGAGAATTCTGTCTTACCAGTGAAGGGTGGGGCTGCCCAGATCAGGCAGCAGGAGTGAGGGGCACAGTCACCCCAGGCCTTGCTGAGCCCAGGTCTGGGTACTGAGTGTCCAGAGCTGCCTCCCCAGGAGGTTAAGGTGGGGGCAAAGGGGAAGCTTCAAGCACTTTGCCTACTTTTGTTCACTCCCCAGTGCACTGTGACTCAGGCCTTCCCATCAGGCCTATTTGTCTACCCAATAAAGCGTGTTTTTTCCAGAAACAAGAAGAGTTGGGAGAGGGAGCTTCAGTGCATGTGGCAGTGCGTGTGCTGGCGCGTATCATTGCACGTATGTTTTCCCTCTTACCGTAGGAAAAATGAAAAAAGAAATCCCTCCTCCATAATCGCAGCTACTCCAGGGGTCAGCGGCGGTGCCCACTCAGTCCCCATCCCTCTCTCTCCCCTCCCGCCAGCGCCCCCTCCCGCCCTCGCCGCAAGCTGGCCCCGGCCTTGCCGGCCCTTCTTAGGGGCTTTATCATGCCTCCTGCAAGAATAGAGATCACACACGGGACGGAAACGTTAGACTCTCATCCCTTGTGCCCATTCCTTGGTCACGGGCCAAGCTGCCGCATCCTTAGCGGTCCAGGCATCGCGGTGCCCCTCGGGCCCCTACCTGGACTAGGCCCACAGCCGGGCTCTAGGGGGCGCGCGATCCACCTCCAGAAGGCCGGCTGCGAAAATCTACCCAGCTACTGGCGACGTCACCGCACCGTAGGCTGAGGATTGGCTGACTCTGATTTAGCATCCTAAAACTTCCGGTTCCAGAGCTTGGCTCGCCAAAGACCCTCCCTCGAGGGAGAGAAACCACAGCCCCCAGAATTCAGCGGGCCTCTCCGAGAGCACGGCGCGTCTGAGGATGCGTAGTAAGGATAACGGGCCCGGAAGCCGGAAGTTCAAAGCCGGCCTCCAGCCAGAGTGACGGCCTGCGCGGACTCCCGCCTTAGTGGGCGGAGTTGTGCCGCGTCTGATGCGCAGTTCCCTTTATAGCGCGGCAAGCCGAATCCTAGAGGCTAACCCGGCAGGTGGGAGGGAGAAAGTTGCTTTCTGCACCAATAGCTGAGGCGTTCAGGGTTGTCCAGGGACGCTACCCTCACGTGTCTGGTTCCGAGTGCTGCGTTCGGCTGTGCTGGGAAGTTGCGTAGACAGTGGCCTCGAGACCCTGCCTGCCTGAGGAGGCCTCGGTTGGATGCGAAGGAGCTGCAGCATCCAGTGCCTCTCCATGAGACCATAAGCTCCTGTATGACAGAAGCCATGTTCTTTTTAGCGGCCTCCGTAGCATGATGGGACAAGATGCCAACTGGCAAG