Transcript asmbl_25798

Sequence
Transcript Sequence for observation asmbl_25798 of TGE0000905:
GGCAGTTGGTGCAGCGGCGGTTGGGGTGAGAGCGCCTACGCCACCCCTCCCCTCCTCCGGCCCCGGCCCCCACCCCGCCGGGCCCAGCCCCAGCCCCGGCCCGGGCTCCAGCCCTAGTACCCGTCCCAGCCCGAGTCGGGTCCGTCCCGTGCGGGCAGGTGCCGCCCCTCTGCCGGCGACGCCCCGGGCCGCCCGCCCGTCCGCTTGCCACCATGGAGCTGGAGGACGGTGTGGTGTATCAGGAGGAGCCCGGCGGCTCCGGGGCCGTGATGTCGGAGCGGGTGTCCGGCCTGGCCGGCTCCATCTACCGCGAGTTCGAGCGGCTTATCGGGCGCTATGACGAGGAGGTGGTCAAAGAGCTGATGCCGCTGGTGGTGGCTGTGCTGGAGAACCTGGACTCGGTGTTCGCGCAGGACCAGGAGCACCAGGTGGAGCTGGAGCTGCTGCGGGACGACAACGAGCAGCTCATCACCCAGTACGAGCGGGAGAAGGCGCTGCGCAAGCACGCTGAGGAGAAATTCATTGAATTTGAAGACTCTCAAGAACAGGAAAAAAAGGACTTACAGACCCGAGTGGAATCTTTAGAATCTCAAACAAGACAACTTGAGCTGAAAGCGAAAAACTATGCTGACCAGATTAGCAGACTTGAAGAAAGAGAAGCAGAACTGAAGAAGGAATATAATGCATTACATCAAAGACACACTGAGATGATCCATAATTATATGGAACATTTAGAAAGAACAAAACTTCATCAGCTCTCAGGGAGTGATCAACTAGAATCCACAGCTCATAGTAGAATTAGAAAAGAACGCCCTATATCATTAGGAATTTTCCCATTACCTGCTGGAGATGGATTGCTTACACCTGATGCTCAGAAAGGAGGAGAGACCCCTGGATCTGAGCAATGGAAATTTCAGGAATTAAGTCAACCACGTTCTCATACCAGCCTGAAGGATGAGCTTTCTGATGTTAGCCAAGGCGGATCTAAAGCTACCACTCCAGCATCAACAGCTAATTCAGATGTGGCAACAATTCCTACTGATACTCCCTTAAAGGAAGAAAACGAAGGATTTGTGAAGGTTACAGATGCGCCAAATAAATCAGAGATAAGCAAACACATTGAAGTACAGGTAGCCCAGGAAACTAGAAATGTATCTACTGGCTCTGCTGAAAATGAAGAAAAGTCAGAAGTTCAAGCAATCATCGAATCTACTCCTGAGCTGGATATGGACAAAGATCTCAGTGGATATAAAGGTTCAAGCACTCCCACCAAAGGCATAGAGAACAAAGCTTTTGATCGCAATACAGAATCTCTCTTTGAAGAACTGTCTTCAGCTGGCTCAGGCCTAATAGGAGATGTGGATGAAGGAGCAGATTTACTAGGAATGGGTCGGGAAGTTGAGAATCTTATATTAGAAAATACACAACTGTTGGAAACCAAAAATGCTTTGAACATAGTGAAGAATGATTTGATAGCAAAAGTGGATGAACTGACCTGTGAGAAAGATGTGCTGCAAGGGGAATTGGAGGCTGTGAAGCAAGCCAAACTGAAACTAGAGGAAAAGAACAGAGAATTGGAGGAAGAGCTTAGGAAAGCTCGGGCAGAAGCTGAAGATGCAAGGCAAAAAGCAAAAGATGACGATGATAGTGATATTCCCACAGCCCAGAGGAAACGGTTTACTAGAGTAGAAATGGCCCGTGTTCTCATGGAGCGAAACCAGTATAAAGAGAGATTGATGGAGCTTCAGGAAGCTGTTCGATGGACAGAGATGATTCGGGCATCACGAGAAAATCCAGCCATGCAGGAAAAAAAAAGGTCAAGCATTTGGCAGTTTTTCAGCCGACTTTTCAGCTCCTCAAGTAACACGACTAAGAAGCCTGAACCACCTGTTAATCTGAAGTACAATGCACCCACGTCTCATGTTACTCCGTCCGTCAAGAAAAGAAGCAGCACCTTATCTCAGCTCCCTGGGGATAAGTCCAAAGCCTTTGATTTCCTTAGTGAAGAAACTGAAGCTAGTTTAGCCTCACGCAGAGAACAAAAGAGAGAGCAGTATCGTCAGGTAAAAGCACATGTTCAGAAGGAAGACGGTAGAGTGCAGGCTTTTGGCTGGAGTCTGCCTCAGAAGTACAAACAGGTAACCAATGGTCAAGGTGAAAATAAGATGAAAAATTTACCTGTGCCTGTCTATCTCAGACCTCTGGATGAAAAAGATACATCAATGAAGCTGTGGTGTGCTGTTGGAGTCAATTTATCTGGTGGGAAGACCAGAGATGGTGGTTCTGTTGTTGGAGCAAGTGTATTTTACAAGGATGTTGCTGGTTTGGATACAGAAGGCAGTAAACAGCGAAGTGCCTCTCAGAGTAGTTTAGATAAGTTAGATCAGGAACTTAAGGAACAGCAGAAGGAGTTAAAAAATCAAGAAGAATTATCCAGTCTAGTTTGGATCTGTACCAGCACTCATTCGGCTACAAAAGTTCTTATTATTGATGCTGTTCAACCTGGCAACATCCTAGACAGTTTCACTGTTTGCAACTCTCATGTTCTGTGCATTGCAAGTGTGCCAGGTGCACGAGAAACAGACTACCCTGCAGGAGAAGATCTTTCAGAATCTGGTCAGGTAGACAAAGCATCTTTATGTGGAAGTATGACAAGCAACAGCTCAGCAGAGACAGACAGCCTGTTAGGAGGCATCACAGTGGTTGGTTGTTCTGCAGAAGGTGTGACGGGAGCTGCCACTTCCCCTAGTACAAATGGTGCTTCTCCAGTGATGGATAAACCACCAGAAATGGAAGCAGAAAATAGTGAGGTTGATGAAAATGTTCCAACAGCAGAAGAAGCAACTGAAGCTACAGAAGGGAATGCGGGGTCAGCTGAAGACACAGTGGACATCTCCCAAACTGGCGTCTACACAGAGCATGTCTTTACAGATCCTTTGGGAGTTCAGATCCCAGAAGACCTCTCCCCAGTGTATCAGTCGAGCAATGACTCAGATGCATATAAAGATCAAATATCAGTACTGCCAAATGAACAAGACTTGGTGAGAGAAGAAGCCCAGAAAATGAGTAGTCTTTTACCAACTATGTGGCTTGGAGCTCAAAATGGCTGTTTGTATGTCCATTCATCTGTAGCCCAGTGGAGGAAATGTCTCCATTCCATTAAACTTAAAGATTCGATTCTCAGTATTGTACACGTGAAGGGAATCGTGTTAGTAGCCCTGGCTGACGGCACCCTTGCAATCTTTCACAGAGGAGTGGATGGGCAGTGGGATTTGTCAAACTATCACCTCTTAGACCTTGGACGGCCTCATCATTCCATCCGTTGCATGACTGTGGTACATGACAAAGTCTGGTGTGGCTATAGGAACAAAATCTATGTGGTGCAGCCAAAGGCCATGAAAATAGAGAAATCTTTTGATGCACATCCCAGGAAGGAGAGCCAAGTGCGACAGCTTGCGTGGGTGGGGGATGGCGTGTGGGTCTCCATTCGCTTGGATTCTACGCTCCGTCTCTATCATGCACACACTTATCAACATCTACAGGATGTGGACATTGAGCCTTATGTAAGCAAAATGTTAGGTACTGGAAAACTGGGCTTCTCTTTTGTGAGAATTACAGCTCTTATGGTGTCTTGTAATCGTTTGTGGGTGGGGACAGGAAATGGTGTCATTATCTCCATCCCATTGACAGAAACCGTAATCCTCCACCAGGGACGTTTACTGGGGCTGAGGG