Transcript asmbl_42227

Sequence
Transcript Sequence for observation asmbl_42227 of TGE0058636:
GGCGTCCTCGTGGAAGGTTCGTGTGCTAGTTAGATGGGCGCCAGGGGTCGCCGGCGGGAAGCATGGAGGGGTCTTTGGGGGCCTTTGGGAACATGGAGTCCTATTCTGTTCCGCCTGGGGCCTCGGTGGCGGCTTGCACGCCCCGAGATGACGGCCGCTGCCCTAGGCAGGGCCGGCGGGCGATTGCGCGTGTCCTGCTCCTCTTAGGCCCGGGACCGCGGGATGGGTGTCGGCGTGACCAGGCCTGAGCTCCCTGTCTCTCCTCAGTGACATCGTCTTTAAACCCTGCGTGGCAATCCCTGACGCACCGCCGTGATGCCCAGGGAAGACAGGGCGACCTGGAAGTCCAACTACTTCCTTAAGATCATCCAACTATTGGATGATTATCCGAAATGTTTCATTGTGGGAGCAGACAATGTGGGCTCCAAGCAGATGCAGCAGATCCGCATGTCCCTTCGCGGGAAGGCTGTGGTGCTGATGGGCAAGAACACCATGATGCGCAAGGCCATCCGAGGGCACCTGGAAAACAACCCAGCTCTGGAGAAACTGCTGCCTCATATCCGGGGGAATGTGGGCTTTGTGTTCACCAAGGAGGACCTCACTGAGATCAGGGACATGTTGCTGGCCAATAAGGTGCCAGCTGCTGCCCGTGCTGGTGCCATTGCCCCATGTGAAGTCACTGTGCCAGCCCAGAACACTGGTCTCGGGCCCGAGAAGACCTCCTTTTTCCAGGCTTTAGGTATCACCACTAAAATCTCCAGGGGCACCATTGAAATCCTGGGTGTCCGCAATGTTGCCAGTGTCTGTCTGCAGATTGGCTACCCAACTGTTGCATCAGTACCCCATTCTATCATCAACGGGTACAAACGAGTCCTGGCCTTGTCTGTGGAGACGGATTACACCTTCCCACTTGCTGAAAAGGTCAAGGCCTTCTTGGCTGATCCATCTGCCTTTGTGGCTGCTGCCCCTGTGGCTGCTGCCACCACAGCTGCTCCTGCTGCTGCTGCAGCCCCAGCTAAGGTTGAAGCCAAGGAAGAGTCGGAGGAGTCGGACGAGGATATGGGATTTGGTCTCTTTGACTAATCACCAAAAAGCAACCAACTTAGCCAGTTTTATTTGCAAAACAAGGAAATAAAGGCTTACTTCTTTA