Transcript asmbl_41957

Sequence
Transcript Sequence for observation asmbl_41957 of TGE0056185:
GGTATTTGAGCTAGTTAAACACATATCTCTCTCCCATTCCATAGGGAATGAGCTGGGCTGTCCTTTCTCCCCACGTTCACCTGCACTTCGTTAGAGAGCAGTGTTCACATGCCACACCACAAGATCCCCACAATGACATAACTCCATTCAGAGACTGGCGTGACTGGGCTGGGTCTCCCCACCCCCCTTCAGCTCTTGTATCACTCAGAATCTGGCAGCCAGTTCCGTCCTGACAGAGTTCACAGCATATATTGGTGGATTCTTGTCCATAGTGCATCTGCTTTAAGAATTAACGAAAGCAGTGTCAAGACAGTAAGGATTCAAACCATTTGCCAAAAATGAGTCTAAGTGCATTTACTCTCTTCCTGGCATTGATTGGTGGTACCAGTGGCCAGTACTATGATTATGATTTTCCCCTATCAATTTATGGGCAATCATCACCAAACTGTGCACCAGAATGTAACTGCCCTGAAAGCTACCCAAGTGCCATGTACTGTGATGAGCTGAAATTGAAAAGTGTACCAATGGTGCCTCCTGGAATCAAGTATCTTTACCTTAGGAATAACCAGATTGACCATATTGATGAAAAGGCCTTTGAGAATGTAACTGATCTGCAGTGGCTCATTCTAGATCACAACCTTCTAGAAAACTCCAAGATAAAAGGGAGAGTTTTCTCTAAATTGAAACAACTGAAGAAGCTGCATATAAACCACAACAACCTGACAGAGTCTGTGGGCCCACTTCCCAAATCTCTGGAGGATCTGCAGCTTACTCATAACAAGATCACAAAGCTGGGCTCTTTTGAAGGATTGGTAAACCTGACCTTCATCCATCTCCAGCACAATCGGCTGAAAGAGGATGCTGTTTCAGCTGCTTTTAAAGGTCTTAAATCACTCGAATACCTTGACTTGAGCTTCAATCAGATAGCCAGACTGCCTTCTGGTCTCCCTGTCTCTCTTCTAACTCTCTACTTAGACAACAATAAGATCAGCAACATCCCTGATGAGTATTTCAAGCGTTTTAATGCATTGCAGTATCTGCGTTTATCTCACAACGAACTGGCTGATAGTGGAATACCTGGAAATTCTTTCAATGTGTCATCCCTGGTTGAGCTGGATCTGTCCTATAACAAGCTTAAAAACATACCAACTGTCAATGAAAACCTTGAAAACTATTACCTGGAGGTCAATCAACTTGAGAAGTTTGACATAAAGAGCTTCTGCAAGATCCTGGGGCCATTATCCTACTCCAAGATCAAGCATTTGCGTTTGGATGGCAATCGCATCTCAGAAACCAGTCTTCCACCGGATATGTATGAATGTCTACGTGTTGCTAACGAAGTCACTCTTAATTAATATCTGTATCCTGGAACAATATTTTATGGTTATGTTTTTCTGTGTGTCAGTTTTCATAGTATCCATATTTTATTACTGTTTATTACTTCCATGAATTTTAAAATCTGAGGGAAATGTTTTGTAAACATTTATTTTTTTTAAAGAAAAGATGAAAGGCAGGCCTATTTCATCACAAGAACACACACATATACACGAATAGACATCAAACTCAATGCTTTATTTGTAAATTTAGTGTTTTTTTATTTCTACTGTCAAATGATGTGCAAAACCTTTTACTGGTTGCATGGAAATCAGCCAAGTTTTATAATCCTTAAATCTTAATGTTCCTCAAAGCTTGGATTAAATACATATGGATGTTACTCTCTTGCACCAAATTATCTTGATACATTCAAATTTGTCTGGTTAAAAAATAGGTGGTAGATATTGAGGCCAAGAATATTGCAAAATACATGAAGCTTCATGCACTTAAAGAAGTATTTTTAGAATAAGAATTTGCATACTTACCTAGTGAAACTTTTCTAGAATTATTTTTCACTCTAAGTCATGTATGTTTCTCTTTGATTATTTGCATGTTATGTTTAATAAGCTACTAGCAAAATAAAACATAGCAAATGGCATCACTGTGTTTGACTTCTTGTGAAATTTCTGTACTTTGTATATAAAATACATAAAACAATAGATTAGAAATCAAAAGATATCTCTGGCCTGCAATATTTTACTGATGTGAACATAGGATTTTCCACTAAATAATTTGTCTACTTCTAGCATTCACTTACAAAGAGTTCTTAAAAACACCTATAATAGGTACTTAGATTTCACAACTTACTTAGATATTTGTCATTATTCCCATTCCTGGTGTTTTTACTGGTTCATATACAATGGTATTCTATTAGATAAGAAGCTGCTATGTGATCTCAGCACTCACTCCTTGGTTGTCAAGAAATGGTGGATAACTCACAGGATTAAAAATGAATGAATATAAAATTTTCTGAAATAGATATTTAAAAAATCATTTTAGCTTGAAGCCAATATGTCTGGATCATAGGTTTTGAGTTCATAATCCAGTAATAACAGCTTTCAGCTTTCTATGAGTATATACAATTCTATACAATGATAAATACTCTGCATATAATTTATAAAAATAACTTCTGTTTTACCTAGTTAACAATAAAACCTATGTGTGGAGCCAAATGTTATGCAGACAAAGGTCTGCTCATCCCATACCAGTGTATATATAGTCAAATATGTGTCTAGTACAAATAAAATGTATCTCTAAGGCATAAAATGTTTTAACACACCACTTTTAGTGAACTCTATCTTATGGTACAGCGGCCTTTCATCAGAGGATCATCATTGAGACTGAGTTGACTGGCAGATATGTGCGATGGATATTACATTAGGTACAATGTGTATTTTTGATTTTCATGAGTTTTCTACATTAAGGTAAATTCCTTAGAGTGTGATAGCAGCCTCAGTTTATTTGTTGGTTTAAACTTGAAATCTACTTTTTCTCGATAAAACTATAATGTAGATGAATTGAAAATGAATTTTCTTTTCCCTGTCTACAAAAGTCACTATCAAGCCTTGGAAACCTATTCTCAAATAGAGGGTAGATAATGTGCCATAAATTCTCTTTTAGAAAGAATGTGATGGAATTAAATGAGCTTTGTCTCTATACTACTTAGAGG