Transcript asmbl_41766

Sequence
Transcript Sequence for observation asmbl_41766 of TGE0058633:
CTTCAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGCCTCCGGGGCCTTGCGGAGACTCACCCCTTCAGCGTCGCTGCCCCCAGCTCAGCTCTTACTGCGGGCCGCTCCGACGGCGGTCCATCCTGTCAGGGACTATGCGGCGCAAACATCTCCTTCGCCAAAAGCAGGCGCCGCCACCGGGCGCATCGTGGCGGTCATTGGCGCAGTGGTGGACGTCCAGTTTGATGAGGGACTACCACCAATTCTAAATGCCCTGGAAGTGCAAGGCAGGGAGACCAGACTGGTTTTGGAGGTGGCCCAGCATTTGGGTGAGAGCACAGTAAGGACTATTGCTATGGATGGTACAGAAGGCTTGGTTAGAGGCCAGAAAGTACTGGATTCTGGTGCACCAATCAAAATTCCTGTTGGTCCTGAGACTTTGGGCAGAATCATGAATGTCATTGGAGAACCTATTGATGAAAGAGGTCCCATCAAAACCAAACAATTTGCTCCCATTCATGCTGAGGCTCCAGAGTTCATGGAAATGAGTGTTGAGCAGGAAATTCTGGTGACTGGTATCAAGGTTGTCGATCTGCTAGCTCCCTATGCCAAGGGTGGCAAAATTGGGCTTTTTGGTGGTGCTGGAGTTGGCAAGACTGTACTGATCATGGAGTTAATCAACAATGTCGCCAAAGCCCATGGTGGTTACTCTGTGTTTGCTGGTGTTGGTGAGAGGACCCGTGAAGGCAATGATTTATACCATGAAATGATTGAATCTGGTGTTATCAACTTAAAAGATGCCACCTCTAAGGTAGCGCTGGTATATGGTCAAATGAATGAACCACCTGGTGCTCGTGCCCGGGTAGCTCTGACTGGGCTGACTGTGGCTGAATACTTCAGAGACCAAGAAGGTCAAGATGTACTGCTATTTATTGATAACATCTTTCGCTTCACCCAGGCTGGTTCAGAGGTGTCTGCATTATTGGGCCGAATCCCTTCTGCTGTGGGCTATCAGCCTACCCTGGCCACTGACATGGGTACTATGCAGGAAAGAATTACCACTACCAAGAAGGGATCTATCACCTCTGTACAGGCTATCTATGTGCCTGCTGATGACTTGACTGACCCTGCCCCTGCTACTACGTTTGCCCATTTGGATGCTACCACTGTACTGTCGCGTGCCATTGCTGAGCTGGGCATCTATCCAGCTGTGGATCCTCTAGACTCCACCTCTCGTATCATGGATCCCAACATTGTTGGCAGTGAGCATTACGATGTTGCCCGTGGGGTGCAAAAGATCCTGCAGGACTACAAATCCCTCCAGGATATCATTGCCATCCTGGGTATGGATGAACTTTCTGAGGAAGACAAGTTGACCGTGTCCCGTGCACGGAAAATACAGCGTTTCTTGTCTCAGCCATTCCAGGTTGCTGAGGTCTTCACAGGTCATATGGGGAAGCTGGTACCCCTGAAGGAGACCATCAAAGGATTCCAGCAGATTTTGGCAGGTGAATATGACCATCTCCCAGAACAGGCCTTCTATATGGTGGGACCCATTGAAGAAGCTGTGGCAAAAGCTGATAAGCTGGCTGAAGAGCATTCATCGTGAGGGGTCTTTGTCCTCTGTACTGTCTCTCTCCTTGCCCCTAACCCAAAAAGCTTCATTTTTCTGTGTAGGCTGCACAAGAGCCTTGATTGAAGATATATTCTTTCTGAACAGTATTTAAGGTTTCCAATAAAATGTACACCCCTCAGAA