Transcript asmbl_41765

Sequence
Transcript Sequence for observation asmbl_41765 of TGE0057009:
CTTCAGTCTCCACCCGGACTACGCCATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGCCTCCGGGGCCTTGCGGAGACTCACCCCTTCAGCGTCGCTGCCCCCAGCTCAGCTCTTACTGCGGGCCGCTCCGACGGCGGTCCATCCTGTCAGGGACTATGCGGCGCAAACATCTCCTTCGCCAAAAGCAGGCGCCGCCACCGGGCGCATCGTGGCGGTCATTGGCGCAGTGGTGGACGTCCAGTTTGATGAGGGACTACCACCAATTCTAAATGCCCTGGAAGTGCAAGGCAGGGAGACCAGACTGGTTTTGGAGGTGGCCCAGCATTTGGGTGAGAGCACAGTAAGGACTATTGCTATGGATGGTACAGAAGGCTTGGTTAGAGGCCAGAAAGTACTGGATTCTGGTGCACCAATCAAAATTCCTGTTGGTCCTGAGACTTTGGGCAGAATCATGAATGTCATTGGAGAACCTATTGATGAAAGAGGTCCCATCAAAACCAAACAATTTGCTCCCATTCATGCTGAGGCTCCAGAGTTCATGGAAATGAGTGTTGAGCAGGAAATTCTGGTGACTGGTATCAAGGTTGTCGATCTGCTAGCTCCCTATGCCAAGGGTGGCAAAATTGGGCTTTTTGGTGGTGCTGGAGTTGGCAAGACTGTACTGATCATGGAGTTAATCAACAATGTCGCCAAAGCCCATGGTGGTTACTCTGTGTTTGCTGGTGTTGGTGAGAGGACCCGTGAAGGCAATGATTTATACCATGAAATGATTGAATCTGGTGTTATCAACTTAAAAGATGCCACCTCTAAGGTAAGCATTGAGCTAATTGATGTCCACGTGGTAGTTACGCCAGGAAACTATTGCCAACTGAAGCCATGTTCTATATTTTCTATTTAATTTTTTTTTCTTTTTAAGAAAATGTTAATATTTTCATTTTCGTGTCCCAGGGCCTACAAAGGAAACCTGTTAGTGTTTTCCCCCCCAACTTCCAATACACAAATGGACATTTTCTTTCCTCTTTGATACTGACATTAAATAACATTTCCAGGTTTTCTTTTTGGTAGATAGTCCCATCATTTGAAAGCTAATTTTGGGAGGGCTGGATTGGACGTGGTACATATGTTTCAGTTAAGCCTATTTTGTACTTTTCACTTAACTTGAATAGGTTTTTATTTCCTTTCTACTATAGTTTTGCCTTACTAATATAAGAAGCTGTCTTTTTTTTTTGAACTGCATCTCTAATAGGGAAAAGAAACTTGCACACAAAAACGCTGACACCTTCTGAGAAAGGATCTGTGGTCGTTTCTCCGATTTGGGAACCTTCAGTATGTGGCTTCTCTACTCCTTTGTCAGGTTTTACGATTATGTATGATTACTGCAGGTAGCGCTGGTATATGGTCAAATGAATGAACCACCTGGTGCTCGTGCCCGGGTAGCTCTGACTGGGCTGACTGTGGCTGAATACTTCAGAGACCAAGAAGGTCAAGATGTACTGCTATTTATTGATAACATCTTTCGCTTCACCCAGGCTGGTTCAGAGGTGTCTGCATTATTGGGCCGAATCCCTTCTGCTGTGGGCTATCAGCCTACCCTGGCCACTGACATGGGTACTATGCAGGAAAGAATTACCACTACCAAGAAGGGATCTATCACCTCTGTACAGGCTATCTATGTGCCTGCTGATGACTTGACTGACCCTGCCCCTGCTACTACGTTTGCCCATTTGGATGCTACCACTGTACTGTCGCGTGCCATTGCTGAGCTGGGCATCTATCCAGCTGTGGATCCTCTAGACTCCACCTCTCGTATCATGGATCCCAACATTGTTGGCAGTGAGCATTACGATGTTGCCCGTGGGGTGCAAAAGATCCTGCAGGACTACAAATCCCTCCAGGATATCATTGCCATCCTGGGTATGGATGAACTTTCTGAGGAAGACAAGTTGACCGTGTCCCGTGCACGGAAAATACAGCGTTTCTTGTCTCAGCCATTCCAGGTTGCTGAGGTCTTCACAGGTCATATGGGGAAGCTGGTACCCCTGAAGGAGACCATCAAAGGATTCCAGCAGATTTTGGCAGGTGAATATGACCATCTCCCAGAACAGGCCTTCTATATGGTGGGACCCATTGAAGAAGCTGTGGCAAAAGCTGATAAGCTGGCTGAAGAGCATTCATCGTGAGGGGTCTTTGTCCTCTGTACTGTCTCTCTCCTTGCCCCTAACCCAAAAAGCTTCATTTTTCTGTGTAGGCTGCACAAGAGCCTTGATTGAAGATATATTCTTTCTGAACAGTATTTAAGGTTTCCAATAAAATGTACACCCCTCAGAA