Transcript asmbl_41728

Sequence
Transcript Sequence for observation asmbl_41728 of TGE0058631:
CTTGAGGACCCCGGGCTGGGCGCCGCCGCCGGTTCGTCTACTCTTTCCTTCAGCCGCCTCCTTTCAACCTTGTCAACCCGTCGGCGCGGCCTCTGGTGCAGCGGCGGCGGCTCCTGTTCCTGCCGCAGCTCTCTCCCTTTCTTACCTCCCCACCAGATCCCGGAGATCGCCCGCCATGGCTTTACTTACTGCGGCCGCCCGGCTCTTGGGAACCAAGAATGCATCTTGTCTTGTTCTTGCAGCCCGGCATGCCAGTGCTTCCTCCACGAATTTGAAAGACATATTGGCTGACCTGATACCTAAGGAGCAGGCCAGAATTAAGACTTTCAGGCAGCAACATGGCAAGACGGTGGTGGGCCAAATCACTGTGGACATGATGTATGGTGGCATGAGAGGCATGAAGGGATTGGTCTATGAAACATCAGTTCTTGATCCTGATGAGGGCATCCGTTTCCGAGGCTTTAGTATCCCTGAATGCCAGAAACTGCTACCCAAGGCTAAGGGTGGGGAAGAACCCCTGCCTGAGGGCTTATTTTGGCTGCTGGTAACTGGACATATCCCAACAGAGGAACAGGTATCTTGGCTCTCAAAAGAGTGGGCAAAGAGGGCAGCTCTGCCTTCCCATGTGGTCACCATGCTGGACAACTTTCCCACCAATCTACACCCCATGTCTCAGCTCAGTGCAGCTGTTACAGCCCTCAACAGTGAAAGTAACTTTGCCCGAGCATATGCACAGGGTATCAGCCGAACCAAGTACTGGGAGTTGATTTATGAAGACTCTATGGATCTAATCGCAAAGCTACCTTGTGTTGCAGCAAAGATCTACCGAAATCTCTACAGAGAAGGCAGCGGTATTGGGGCCATTGACTCTAACCTGGACTGGTCTCACAATTTCACCAACATGTTAGGCTATACTGATCATCAGTTCACTGAGCTCACGCGCCTGTACCTCACCATCCACAGTGACCATGAGGGTGGCAATGTAAGTGCCCATACCAGCCATTTGGTGGGCAGTGCCCTTTCCGACCCTTACCTGTCCTTTGCAGCAGCCATGAACGGGCTGGCAGGGCCTCTCCATGGACTGGCAAATCAGGAAGTGCTTGTCTGGCTAACACAGCTGCAGAAGGAAGTTGGCAAAGATGTGTCAGATGAGAAGTTACGAGACTACATCTGGAACACACTCAACTCAGGACGGGTTGTTCCAGGCTATGGCCATGCAGTACTAAGGAAGACTGATCCGCGATATACCTGTCAGCGAGAGTTTGCTCTGAAACACCTGCCTAATGACCCCATGTTTAAGTTGGTTGCTCAGCTGTACAAGATTGTGCCCAATGTCCTCTTAGAGCAGGGTAAAGCCAAGAATCCTTGGCCCAATGTAGATGCTCACAGTGGGGTGCTGCTCCAGTATTATGGCATGACGGAGATGAATTACTACACGGTCCTGTTTGGGGTGTCACGAGCATTGGGTGTACTGGCACAGCTCATCTGGAGCCGAGCCTTAGGCTTCCCTCTAGAAAGGCCCAAGTCCATGAGCACAGAGGGTCTGATGAAGTTTGTGGACTCTAAGTCAGGGTAAAACTGGAGACTGGGTGAAAGTGACTACCAGAAAGTGAGGAAGCCTAAATAAAAAGTATACTTTTGTTTCAGGGGGCCTTTAAAGACTTAAGATTAAATTATATCTGAGGCACTGATAATATGTTTGAGGTTAAAATATAAATTAAGACTTTAAAAGATGAAAAATGGTCCCTTCTTCCCTAATCAGCTCCCTTCCCCTGCCTGGTATGAGTTGCCCATCATACGCATGGTCCTGGAGGATGACCAGGACTAATGCATGTGGTATGAGTAGGTTTGGCCCCCTCACTATCTCTAGAGTGAGAATCTGGCTCCTGTTTCCATGGGTCAAAGCCGGTTGCAGAGAATCTGTAGTCACTTTGGAGCTTTAGCTTCTCTGCCAAGCCCTCAATAAGCCAGCAAACCAGGACTCTGCCCCTTCTGTTTCCATAGGAATCATGTTGGATAGTCAGCTGTACCAAGCCCCTTGGCCCTCTCCCATGCACACAAACACCTCCTAGCAAGACCTGTTGGTTAGCTGGACATGCTTTGGCAATTTTTTTATACTACCAAGTGACCATAAAGGCATGGCATTTGTTGTGACTGGCACCCAATGTTTGATTTTTTTTTTAAAACTATCCAATTAAAATTAAGGTCTGGGAGTGTTCTGTTTCCCATTACTTTAATACTCACCTCCTCCCAGACTTTCTACACCTGTTGCACCTCAGGCAGAGGATGTTCTGGACCTCCCCCTCTTGGTCCCTACTAGAGACCTCTCAACAGATCTGTGGGCCCAGTCATTGGGTTTTATCAGTGCTTAATGTGAACTAAGTTTTTTACTTCCACAGAATACAAGCCACTACCTTCTGACCTCCCCACCCCCCACCAACCCCCATCTTTTAATATGCTGTGGGGCATAGAACTCCGGAATGACCAGCATGATATTTTCAGAGTCTTGTCCCCGGGGTATTAGCACCTCTTTTTGAACAGGGAATTGATTCAAGATTGGACATGGTCTCCTCTGATTATCAGGTACTGGGGCTGAGGGCATTAAAAATAGTAAGCCTCCCTCCTCGTCCCCTGCCTCAAGAAATTGCCTCCTTATTTATCAACATCTTTTTCCTCCCTTTCCCTGAGAGCTCACAGTACAATGTTTCAGAAGCCCCATTTGCACAGGTTTTCAGCAACTCAGAATGCTCTACTTCTTTTTCTTTGAGAAAGGATTAAGATACACTCCTGCTGTGCCCCCATCTTTCCTCCAAACTCCTGCCTGTGTTTGTGTGGATACCCAGTCCCAGAACCACACTGTTGAGTTGGACACACTGTAAACCCCTGGGTAACTGTCAAGTCATGATGGAGACTTCAGGTTGTTCTGTATAAAATGCAAAATAAATGTTTTTATTAACAATG