Transcript asmbl_41093

Sequence
Transcript Sequence for observation asmbl_41093 of TGE0056496:
CAGCTATTGTGGTGGGAAAGGGAGGGTGGTTGGTGGATGTCACAGCTTGGGCTTTATCTCCCCCAGCAGTGGGGACTCCACAGCCCCTGGGCTACATAACAGCAAGACAGTCCGGAGCTGTAGCAGACCTGATTGAGCCTTTGCAGCAGCTGAGAGCATGGCCTAGGGTGGGCGGCACCATTGTCCAGCAGCTGAGTTTCCCAGGGACCTTGGAGATAGCCGCAGCCCTCATTTGCAGGGGAAGATGATTCCTGCCAGATTTGCCGGGGTGCTGCTTGCTCTGGCCCTCATTTTGCCAGGGACCCTTTGTGCAGAAGGAACTCGCGGCAGGTCATCCACGGCCCGATGCAGCCTTTTCGGAAGTGACTTCGTCAACACCTTTGATGGGAGCATGTACAGCTTTGCGGGATACTGCAGTTACCTCCTGGCAGGGGGCTGCCAGAAACGCTCCTTCTCGATTATTGGGGACTTCCAGAATGGCAAGAGAGTGAGCCTCTCCGTGTATCTTGGGGAATTTTTTGACATCCATTTGTTTGTCAATGGTACCGTGACACAGGGGGACCAAAGAGTCTCCATGCCCTATGCCTCCAAAGGGCTGTATCTAGAAACTGAGGCTGGGTACTACAAGCTGTCCGGTGAGGCCTATGGCTTTGTGGCCAGGATCGATGGCAGCGGCAACTTTCAAGTCCTGCTGTCAGACAGATACTTCAACAAGACCTGCGGGCTGTGTGGCAACTTTAACATCTTTGCTGAAGATGACTTTATGACCCAAGAAGGGACCTTGACCTCGGACCCTTATGACTTTGCCAACTCATGGGCTCTGAGCAGTGGAGAACAGTGGTGTGAACGGGCATCTCCTCCCAGCAGCTCATGCAACATCTCCTCTGGGGAAATGCAGAAGGGCCTGTGGGAGCAGTGCCAGCTTCTGAAGAGCACCTCGGTGTTTGCCCGCTGCCACCCTCTGGTGGACCCCGAGCCTTTTGTGGCCCTGTGTGAGAAGACTTTGTGTGAGTGTGCTGGGGGGCTGGAGTGCGCCTGCCCTGCCCTCCTGGAGTACGCCCGGACCTGTGCCCAGGAGGGAATGGTGCTGTACGGCTGGACCGACCACAGCGCGTGCAGCCCAGTGTGCCCTGCTGGTATGGAGTATAGGCAGTGTGTGTCCCCTTGCGCCAGGACCTGCCAGAGCCTGCACATCAATGAAATGTGTCAGGAGCGATGCGTGGATGGCTGCAGCTGCCCTGAGGGACAGCTCCTGGATGAAGGCCTCTGCGTGGAGAGCACCGAGTGTCCCTGCGTGCATTCCGGAAAGCGCTACCCTCCCGGCACCTCCCTCTCTCGAGACTGCAACACCTGCATTTGCCGAAACAGCCAGTGGATCTGCAGCAATGAAGAATGTCCAGGGGAGTGCCTTGTCACAGGTCAATCACACTTCAAGAGCTTTGACAACAGATACTTCACCTTCAGTGGGATCTGCCAGTACCTGCTGGCCCGGGATTGCCAGGACCACTCCTTCTCCATTGTCATTGAGACTGTCCAGTGTGCTGATGACCGCGACGCTGTGTGCACCCGCTCCGTCACCGTCCGGCTGCCTGGCCTGCACAACAGCCTTGTGAAACTGAAGCATGGGGCAGGAGTTGCCATGGATGGCCAGGACGTCCAGCTCCCCCTCCTGAAAGGTGACCTCCGCATCCAGCATACAGTGACGGCCTCCGTGCGCCTCAGCTACGGGGAGGACCTGCAGATGGACTGGGATGGCCGCGGGAGGCTGCTGGTGAAGCTGTCCCCCGTCTATGCCGGGAAGACCTGCGGCCTGTGTGGGAATTACAATGGCAACCAGGGCGACGACTTCCTTACCCCCTCTGGGCTGGCGGAGCCCCGGGTGGAGGACTTCGGGAACGCCTGGAAGCTGCACGGGGACTGCCAGGACCTGCAGAAGCAGCACAGCGATCCCTGCGCCCTCAACCCGCGCATGACCAGGTTCTCCGAGGAGGCGTGCGCGGTCCTGACGTCCCCCACATTCGAGGCCTGCCATCGTGCCGTCAGCCCGCTGCCCTACCTGCGGAACTGCCGCTACGACGTGTGCTCCTGCTCGGACGGCCGCGAGTGCCTGTGCGGCGCCCTGGCCAGCTATGCCGCGGCCTGCGCGGGGAGAGGCGTGCGCGTCGCGTGGCGCGAGCCAGGCCGCTGTGAGCTGAACTGCCCGAAAGGCCAGGTGTACCTGCAGTGCGGGACCCCCTGCAACCTGACCTGCCGCTCTCTCTCTTACCCGGATGAGGAATGCAATGAGGCCTGCCTGGAGGGCTGCTTCTGCCCCCCAGGGCTCTACATGGATGAGAGGGGGGACTGCGTGCCCAAGGCCCAGTGCCCCTGTTACTATGACGGTGAGATCTTCCAGCCAGAAGACATCTTCTCAGACCATCACACCATGTGCTACTGTGAGGATGGCTTCATGCACTGTACCATGAGTGGAGTCCCCGGAAGCTTGCTGCCTGACGCTGTCCTCAGCAGTCCCCTGTCTCATCGCAGCAAAAGGAGCCTATCCTGTCGGCCCCCCATGGTCAAGCTGGTGTGTCCCGCTGACAACCTGCGGGCTGAAGGGCTCGAGTGTACCAAAACGTGCCAGAACTATGACCTGGAGTGCATGAGCATGGGCTGTGTCTCTGGCTGCCTCTGCCCCCCGGGCATGGTCCGGCATGAGAACAGATGTGTGGCCCTGGAAAGGTGTCCCTGCTTCCATCAGGGCAAGGAGTATGCCCCTGGAGAAACAGTGAAGATTGGCTGCAACACTTGTGTCTGTCAGGACCGGAAGTGGAACTGCACAGACCATGTGTGTGATGCCACGTGCTCCACGATCGGCATGGCCCACTACCTCACCTTCGACGGGCTCAAATACCTGTTCCCCGGGGAGTGCCAGTACGTTCTGGTGCAGGATTACTGCGGCAGTAACCCTGGGACCTTTCGGATCCTAGTGGGGAATAAGGGATGCAGCCACCCCTCAGTGAAATGCAAGAAACGGGTCACCATCCTGGTGGAGGGAGGAGAGATTGAGCTGTTTGACGGGGAGGTGAATGTGAAGAGGCCCATGAAGGATGAGACTCACTTTGAGGTGGTGGAGTCTGGCCGGTACATCATTCTGCTGCTGGGCAAAGCCCTCTCCGTGGTCTGGGACCGCCACCTGAGCATCTCCGTGGTCCTGAAGCAGACATACCAGGAGAAAGTGTGTGGCCTGTGTGGGAATTTTGATGGCATCCAGAACAATGACCTCACCAGCAGCAACCTCCAAGTGGAGGAAGACCCTGTGGACTTTGGGAACTCCTGGAAAGTGAGCTCGCAGTGTGCTGACACCAGAAAAGTGCCTCTGGACTCATCCCCTGCCACCTGCCATAACAACATCATGAAGCAGACGATGGTGGATTCCTCCTGTAGAATCCTTACCAGTGACGTCTTCCAGGACTGCAACAAGCTGGTGGACCCCGAGCCATATCTGGATGTCTGCATTTACGACACCTGCTCCTGTGAGTCCATTGGGGACTGCGCCTGCTTCTGCGACACCATTGCTGCCTATGCCCACGTGTGTGCCCAGCATGGCAAGGTGGTGACCTGGAGGACGGCCACATTGTGCCCCCAGAGCTGCGAGGAGAGGAATCTCCGGGAGAACGGGTATGAGTGTGAGTGGCGCTATAACAGCTGTGCACCTGCCTGTCAAGTCACGTGTCAGCACCCTGAGCCACTGGCCTGCCCTGTGCAGTGTGTGGAGGGCTGCCATGCCCACTGCCCTCCAGGGAAAATCCTGGATGAGCTTTTGCAGACCTGCGTTGACCCTGAAGACTGTCCAGTGTGTGAGGTGGCTGGCCGGCGTTTTGCCTCAGGAAAGAAAGTCACCTTGAATCCCAGTGACCCTGAGCACTGCCAGATTTGCCACTGTGATGTTGTCAACCTCACCTGTGAAGCCTGCCAGGAGCCGGGAGGCCTGGTGGTGCCTCCCACAGATGCCCCGGTGAGCCCCACCACTCTGTATGTGGAGGACATCTCGGAACCGCCGTTGCACGATTTCTACTGCAGCAGGCTACTGGACCTGGTCTTCCTGCTGGATGGCTCCTCCAGGCTGTCCGAGGCTGAGTTTGAAGTGCTGAAGGCCTTTGTGGTGGACATGATGGAGCGGCTGCGCATCTCCCAGAAGTGGGTCCGCGTGGCCGTGGTGGAGTACCACGACGGCTCCCACGCCTACATCGGGCTCAAGGACCGGAAGCGACCGTCAGAGCTGCGGCGCATTGCCAGCCAGGTGAAGTATGCGGGCAGCCAGGTGGCCTCCACCAGCGAGGTCTTGAAATACACACTGTTCCAAATCTTCAGCAAGATCGACCGCCCTGAAGCCTCCCGCATCACCCTGCTCCTGATGGCCAGCCAGGAGCCCCAACGGATGTCCCGGAACTTTGTCCGCTACGTCCAGGGCCTGAAGAAGAAGAAGGTCATTGTGATCCCGGTGGGCATTGGGCCCCATGCCAACCTCAAGCAGATCCGCCTCATCGAGAAGCAGGCCCCTGAGAACAAGGCCTTCGTGCTGAGCAGTGTGGATGAGCTGGAGCAGCAAAGGGACGAGATCGTTAGCTACCTCTGTGACCTTGCCCCTGAAGCCCCTCCTCCTACTCTGCCCCCCGACATGGCACAAGTCACTGTGGGCCCGGGGCTCTTGGGGGTTTCGACCCTGGGGCCCAAGAGGAACTCCATGGTTCTGGATGTGGCGTTCGTCCTGGAAGGATCGGACAAAATTGGTGAAGCCGACTTCAACAGGAGCAAGGAGTTCATGGAGGAGGTGATTCAGCGGATGGATGTGGGCCAGGACAGCATCCACGTCACGGTGCTGCAGTACTCCTACATGGTGACTGTGGAGTACCCCTTCAGCGAGGCACAGTCCAAAGGGGACATCCTGCAGCGGGTGCGAGAGATCCGCTACCAGGGCGGCAACAGGACCAACACTGGGCTGGCCCTGCGGTACCTCTCTGACCACAGCTTCTTGGTCAGCCAGGGTGACCGGGAGCAGGCGCCCAACCTGGTCTACATGGTCACCGGAAATCCTGCCTCTGATGAGATCAAGAGGCTGCCTGGAGACATCCAGGTGGTGCCCATTGGAGTGGGCCCTAATGCCAACGTGCAGGAGCTGGAGAGGATTGGCTGGCCCAATGCCCCTATCCTCATCCAGGACTTTGAGACGCTCCCCCGAGAGGCTCCTGACCTGGTGCTGCAGAGGTGCTGCTCCGGAGAGGGGCTGCAGATCCCCACCCTCTCCCCTGCACCTGACTGCAGCCAGCCCCTGGACGTGATCCTTCTCCTGGATGGCTCCTCCAGTTTCCCAGCTTCTTATTTTGATGAAATGAAGAGTTTCGCCAAGGCTTTCATTTCAAAAGCCAATATAGGGCCTCGTCTCACTCAGGTGTCAGTGCTGCAGTATGGAAGCATCACCACCATTGACGTGCCATGGAACGTGGTCCCGGAGAAAGCCCATTTGCTGAGCCTTGTGGACGTCATGCAGCGGGAGGGAGGCCCCAGCCAAATCGGGGATGCCTTGGGCTTTGCTGTGCGATACTTGACTTCAGAAATGCATGGTGCCAGGCCGGGAGCCTCAAAGGCGGTGGTCATCCTGGTCACGGACGTCTCTGTGGATTCAGTGGATGCAGCAGCTGATGCCGCCAGGTCCAACAGAGTGACAGTGTTCCCTATTGGAATTGGAGATCGCTACGATGCAGCCCAGCTACGGATCTTGGCAGGCCCAGCAGGCGACTCCAACGTGGTGAAGCTCCAGCGAATCGAAGACCTCCCTACCATGGTCACCTTGGGCAATTCCTTCCTCCACAAACTGTGCTCTGGATTTGTTAGGATTTGCATGGATGAGGATGGGAATGAGAAGAGGCCCGGGGACGTCTGGACCTTGCCAGACCAGTGCCACACCGTGACTTGCCAGCCAGATGGCCAGACCTTGCTGAAGAGTCATCGGGTCAACTGTGACCGGGGGCTGAGGCCTTCGTGCCCTAACAGCCAGTCCCCTGTTAAAGTGGAAGAGACCTGTGGCTGCCGCTGGACCTGCCCCTGCGTGTGCACAGGCAGCTCCACTCGGCACATCGTGACCTTTGATGGGCAGAATTTCAAGCTGACTGGCAGCTGTTCTTATGTCCTATTTCAAAACAAGGAGCAGGACCTGGAGGTGATTCTCCATAATGGTGCCTGCAGCCCTGGAGCAAGGCAGGGCTGCATGAAATCCATCGAGGTGAAGCACAGTGCCCTCTCCGTCGAGCTGCACAGTGACATGGAGGTGACGGTGAATGGGAGACTGGTCTCTGTTCCTTACGTGGGTGGGAACATGGAAGTCAACGTTTATGGTGCCATCATGCATGAGGTCAGATTCAATCACCTTGGTCACATCTTCACATTCACTCCACAAAACAATGAGTTCCAACTGCAGCTCAGCCCCAAGACTTTTGCTTCAAAGACGTATGGTCTGTGTGGGATCTGTGATGAGAACGGAGCCAATGACTTCATGCTGAGGGATGGCACAGTCACCACAGACTGGAAAACACTTGTTCAGGAATGGACTGTGCAGCGGCCAGGGCAGACGTGCCAGCCCATCCTGGAGGAGCAGTGTCTTGTCCCCGACAGCTCCCACTGCCAGGTCCTCCTCTTACCACTGTTTGCTGAATGCCACAAGGTCCTGGCTCCAGCCACATTCTATGCCATCTGCCAGCAGGACAGTTGCCACCAGGAGCAAGTGTGTGAGGTGATCGCCTCTTATGCCCACCTCTGTCGGACCAACGGGGTCTGCGTTGACTGGAGGACACCTGATTTCTGTGCTATGTCATGCCCACCATCTCTGGTCTACAACCACTGTGAGCATGGCTGTCCCCGGCACTGTGATGGCAACGTGAGCTCCTGTGGGGACCATCCCTCCGAAGGCTGTTTCTGCCCTCCAGATAAAGTCATGTTGGAAGGCAGCTGTGTCCCTGAAGAGGCCTGCACTCAGTGCATTGGTGAGGATGGAGTCCAGCACCAGTTCCTGGAAGCCTGGGTCCCGGACCACCAGCCCTGTCAGATCTGCACATGCCTCAGCGGGCGGAAGGTCAACTGCACAACGCAGCCCTGCCCCACGGCCAAAGCTCCCACGTGTGGCCTGTGTGAAGTAGCCCGCCTCCGCCAGAATGCAGACCAGTGCTGCCCCGAGTATGAGTGTGTGTGTGACCCAGTGAGCTGTGACCTGCCCCCAGTGCCTCACTGTGAACGTGGCCTCCAGCCCACACTGACCAACCCTGGCGAGTGCAGACCCAACTTCACCTGCGCCTGCAGGAAGGAGGAGTGCAAAAGAGTGTCCCCACCCTCCTGCCCCCCGCACCGTTTGCCCACCCTTCGGAAGACCCAGTGCTGTGATGAGTATGAGTGTGCCTGCAACTGTGTCAACTCCACAGTGAGCTGTCCCCTTGGGTACTTGGCCTCAACTGCCACCAATGACTGTGGCTGTACCACAACCACCTGCCTTCCCGACAAGGTGTGTGTCCACCGAAGCACCATCTACCCTGTGGGCCAGTTCTGGGAGGAGGGCTGCGATGTGTGCACCTGCACCGACATGGAGGATGCCGTGATGGGCCTCCGCGTGGCCCAGTGCTCCCAGAAGCCCTGTGAGGACAGCTGTCGGTCGGGCTTCACTTACGTTCTGCATGAAGGCGAGTGCTGTGGAAGGTGCCTGCCATCTGCCTGTGAGGTGGTGACTGGCTCACCGCGGGGGGACTCCCAGTCTTCCTGGAAGAGTGTCGGCTCCCAGTGGGCCTCCCCGGAGAACCCCTGCCTCATCAATGAGTGTGTCCGAGTGAAGGAGGAGGTCTTTATACAACAAAGGAACGTCTCCTGCCCCCAGCTGGAGGTCCCTGTCTGCCCCTCGGGCTTTCAGCTGAGCTGTAAGACCTCAGCGTGCTGCCCAAGCTGTCGCTGTGAGCGCATGGAGGCCTGCATGCTCAATGGCACTGTCATTGGGCCCGGGAAGACTGTGATGATCGATGTGTGCACGACCTGCCGCTGCATGGTGCAGGTGGGGGTCATCTCTGGATTCAAGCTGGAGTGCAGGAAGACCACCTGCAACCCCTGCCCCCTGGGTTACAAGGAAGAAAATAACACAGGTGAATGTTGTGGGAGATGTTTGCCTACGGCTTGCACCATTCAGCTAAGAGGAGGACAGATCATGACACTGAAGCGTGATGAGACGCTCCAGGATGGCTGTGATACTCACTTCTGCAAGGTCAATGAGAGAGGAGAGTACTTCTGGGAGAAGAGGGTCACAGGCTGCCCACCCTTTGATGAACACAAGTGTCTGGCTGAGGGAGGTAAAATTATGAAAATTCCAGGCACCTGCTGTGACACATGTGAGGAGCCTGAGTGCAACGACATCACTGCCAGGCTGCAGTATGTCAAGGTGGGAAGCTGTAAGTCTGAAGTAGAGGTGGATATCCACTACTGCCAGGGCAAATGTGCCAGCAAAGCCATGTACTCCATTGACATCAACGATGTGCAGGACCAGTGCTCCTGCTGCTCTCCGACACGGACGGAGCCCATGCAGGTGGCCCTGCACTGCACCAATGGCTCTGTTGTGTACCATGAGGTTCTCAATGCCATGGAGTGCAAATGCTCCCCCAGGAAGTGCAGCAAGTGAGGCTGCTGCAGCTGCATGGGTGCCTGCTGCTGCCTGCCTTGGCCTGATGGCCAGGCCAGAGTGCTGCCAGTCCTCTGCATGTTCTGCTCTTGTGCCCTTCTGAGCCCACAATAAAGGCTGAGCTCTTATCTTGCAAAAGGCTGCTGGTGCACTGTGTCGTAGGGCTGAGATGGCAACGGTGGGCAGGGGC