Transcript asmbl_40980

Sequence
Transcript Sequence for observation asmbl_40980 of TGE0058624:
GGGTAGACTCTTTCTGGATGTTGTAGTCAGACAGGGTGCGCCCATCTTCCAGCTGCTTTCCGGCAAAGATCAACCTCTGCTGGTCAGGAGGAATGCCTTCCTTGTCTTGGATCTTTGCTTTGACGTTCTCGATAGTGTCACTGGGCTCGACCTCAAGGGTGATGGTCTTGCCAGTGAGTGTCTTCACGAAGATTTGCATCCCACCTCTGAGACGGAGTACCAGGTGCAA