Transcript asmbl_32215

Sequence
Transcript Sequence for observation asmbl_32215 of TGE0056760:
CAATCCTTTAATAAAATTAGTCCATCTAAAACTCCCCAATGCCTAAGGTTCTAGTCGTGGAAGGGTTAGCTGCAGAATTCCAGTTCAGAAGCCAACGGAGGCTCAGTCCAGACAGGGATTAACCGACTTGTGCTGGTATCTAGGTGCTTGGATTGCCGAGTTGAGTTTGCTGGAAGGGAAATGGGGCGGCGTCGGGGGGCCCGACAGGCCTGGCTGCCAGTCGGCTTCCGCGAAAACGACTCTTGCTGTCCACATAGCCAGCCGTGAAGCCAAACTGCAGGCCTCTGCCCTCCCCTAAATGTCCTCCTAGGAGGCAGTCACTCGGGAGGAAGATGTGCCTGTTACCAAGTGCTTCGTCCCGGCCCCAGCGCAGACCTATGAATGAAGATGGAGGGAGAGCTGATGTGAAAGGCCTGGGTCCCGGCCGCAGAAGGGGCGCCAGACCGAAATCGGCGATCGCGTCTCTCCCACCAAAGCCTCCCGGCCAGCGGCCGCGTCTGAAAGTCCTGGGCTAAGCACCACGCCGGGGGGGTACCAGACACCCCGGCTGCAGCTGCCGAGGGCCTCACTCACCTTCAGGGCCGCCGGCCTCTCGGCCTGGACTGCCCACCTCGGCCCTGCGTCAGAGCGGAAGGCCAAGTCTTCCAGAAGGTGCTGCGGCCTCCCCGCAGCCCCTTAGCGACTCGGGATGGGGCGGCTGAGTCACGAACGCCGAGGCGGGCAGGTGCGGCGCCGCCGGCCTCCCCCCGGCAGGCTCGGGTCTTCCGCGCCACGGAGGTCCCCGAAGAGCGCCCAAGCCGCATCCGGAAGGCCCGAACCCTACCGGAGGGCGGACGGCGGACAGGGCAGGGCCCGAGGCCGACGCGGCAGGCGGTGCGGGACGGGAGCGGGGGCGGGCGGGGACTCGAGGCCGGGCGGCGAAGGCGGGCGAGGGGAGGGGAGGGGAAGGGAGCCGCGGCCCGCTTGCCCCGCAGTCTGAAGCGGCTCAGCTCTTTCCATGAGGGCGGTGGTGGCCCTTAAAAGGGCCTTTGTGGTGGCATGGGGAGGCCTGGCGGCCGGCCGCGGCGCGGGCCCTCTTAGTACTCCTGGGAGGCCTGGGTGGCCTTCTTGCCGCCCGAGGGCGCCTTCGGCCCCACGGTGGCGCTGGTCTTCTTGGGCAGCAGCACGGCCTGGATGTTGGGCAGGACGCCTCCCTGGGCGATCGTCACGCCGCCCAGCAGCTTGTTGAGCTCCTCGTCGTTGCGGATGGCCAGCTGCAGGTGGCGGGGGATGATTCGCGTCTTCTTGTTGTCGCGGGCCGCATTGCCCGCCAGCTCCAGGATCTCAGCGGTGAGGTACTCCAGCACTGCCGCCAGGTACACTGGCGCGCCGGCGCCAACGCGCTCGGCGTAGTGGCCCTTCCGCAGCAGCCGGTGTACACGGCCCACTGGGAACTGGAGGCCGGCGCGCGACGAGCGCGACTTGGCCTTGGCGCGGGCCTTGCCGCCAGTCTTGCCGCGGCCCGACATGCTAGCGAGGTAGACCGGTGAAGCACGACGGCTCAAACACTAGAACAGACGCCCGCCGCAGTGTAA