Transcript asmbl_26546

Sequence
Transcript Sequence for observation asmbl_26546 of TGE0056760:
TTACACTGCGGCGGGCGTCTGTTCTAGTGTTTGAGCCGTCGTGCTTCACCGGTCTACCTCGCTAGCATGTCGGGCCGCGGCAAGACTGGCGGCAAGGCCCGCGCCAAGGCCAAGTCGCGCTCGTCGCGCGCCGGCCTCCAGTTCCCAGTGGGCCGTGTACACCGGCTGCTGCGGAAGGGCCACTACGCCGAGCGCGTTGGCGCCGGCGCGCCAGTGTACCTGGCGGCAGTGCTGGAGTACCTCACCGCTGAGATCCTGGAGCTGGCGGGCAATGCGGCCCGCGACAACAAGAAGACGCGAATCATCCCCCGCCACCTGCAGCTGGCCATCCGCAACGACGAGGAGCTCAACAAGCTGCTGGGCGGCGTGACGATCGCCCAGGGAGGCGTCCTGCCCAACATCCAGGCCGTGCTGCTGCCCAAGAAGACCAGCGCCACCGTGGGGCCGAAGGCGCCCTCGGGCGGCAAGAAGGCCACCCAGGCCTCCCAGGAGTACTAAGAGGGCCCGCGCCGCGGCCGGCCGCCAGGCCTCCCCATGCCACCACAAAGGCCCTTTTAAGGGCCACCACCGCCCTCATGGAAAGAGCTGAGCCGCTTCAGACTGCGGGGCAAGCGGGCCGCGGCTCCCTTCCCCTCCCCTCCCCTCGCCCGCCTTCGCCGCCCGGCCTCGAGTCCCCGCCCGCCCCCGCTCCCGTCCCGCACCGCCTGCCGCGTCGGCCTCGGGCCCTGCCCTGTCCGCCGTCCGCCCTCCGGTAGGGTTCGGGCCTTCCGGATGCGGCTTGGGCGCTCTTCGGGGACCTCCGTGGCGCGGAAGACCCGAGCCTGCCGGGGGGAGGCCGGCGGCGCCGCACCTGCCCGCCTCGGCGTTCGTGACTCAGCCGCCCCATCCCGAGTCGCTAAGGGGCTGCGGGGAGGCCGCAGCACCTTCTGGAAGACTTGGCCTTCCGCTCTGACGCAGGGCCGAGGTGGGCAGTCCAGGCCGAGAGGCCGGCGGCCCTGAAGGTCTGCGCTGGGGCCGGGACGAAGCACTTGGTAACAGGCACATCTTCCTCCCGAGTGACTGCCTCCTAGGAGGACATTTAGGGGAGGGCAGAGGCCTGCAGTTTGGCTTCACGGCTGGCTATGTGGACAGCAAGAGTCGTTTTCGCGGAAGCCGACTGGCAGCCAGGCCTGTCGGGCCCCCCGACGCCGCCCCATTTCCCTTCCAGCAAACTCAACTCGGCAATCCAAGCACCTAGATACCAGCACAAGTCGGTTAATCCCTGTCTGGACTGAGCCTCCGTTGGCTTCTGAACTGGAATTCTGCAGCTAACCCTTCCACGACTAGAACCTTAGGCATTGGGGAGTTTTAGATGGACTAATTTTATTAAAGGATTG