Transcript asmbl_25818

Sequence
Transcript Sequence for observation asmbl_25818 of TGE0057963:
GTTACAAGAGCCGCCTCCGCGCACGGGGGCCCGGCCACTCGGAGCTGCTCTGCCGCGGGGACTGCACCGCCCGCCCTGCCAGACCCGCCCGGAACGGGGCTCGTCGCCGCCAGTAGCCGCAGCACCGCAGCCTTGGGCCTCGCGCCGGCTATGGCCGTGCCCTGGGGCTGAGCCCTCAGGTTGTGACCGAGATTCCCGACGAGAGAGACTGAGGGGAAGAGAGGAAGGAGGGGCGGGCTCCTGGCAAGGCATTCGCTCCTGAGCGGAATCCTGCAAAGATGGAGAAGGAGGAGACAACCCGGGAGCTGCTGCTGCCCAACTGGCAGGGTAGTGGCTCCCACGGGCTGACCATCGCCCAGAGGGACGACGGCGTCTTTGTGCAGGAGGTGACGCAGAACTCCCCTGCGGCCCGCACTGGGGTGGTCAAGGAGGGGGACCAGATTGTGGGTGCCACCATCTACTTTGACAACCTGCAGTCGGGTGAGGTGACCCAGCTGCTGAACACCATGGGGCACCACACGGTGGGCCTGAAGCTGCACCGCAAGGGGGACCGCTCTCCCGAGCCTGGCCAGACCTGGACCCGTGAAGTCTTCAGCTCCTGCAGCTCTGAAGTGGTTCTGAGCGGGGATGATGAGGAGTACCAGCGCATCTACACCACGAAGATCAAGCCACGGCTGAAGTCGGAAGATGGAGTGGAAGGAGACCTCGGGGAGACCCAGAGCCGTACCATCACAGTGACCAGAAGGGTCACGGCCTACACTGTGGATGTGACTGGCCGGGAAGGAGCCAAGGACATAGACATCAGTAGCCCTGAATTCAAGATCAAGATTCCAAGACATGAACTGACTGAAATCTCCAATGTGGATGTGGAGACCCAGTCTGGGAAGACCGTGATCAGACTGCCCTCGGGCTCGGGGGCAGCCTCTCCGACAGGCTCTGCTGTGGATATCCGAGCAGGGGCCATTTCTGCTTCAGGACCAGAGCTCCAAGGTGCTGGCCACTCGAAGCTCCAGGTCACCATGCCTGGGATAAAGGTGGGAGGCTCAGGTGTCAATGTCAATGCAAAGGGCTTGGACTTGGGTGGCAGAGGAGGGGTCCAAGTTCCAGCAGTGGACATTTCATCTTCTCTTGGGGGTAGGGCAGTAGAGGTACAGGGCCCATCTCTGGAGAGTGGTGATCATGGCAAAATTAAATTTCCCACCATGAAAGTGCCGAAATTTGGTGTCTCAACAGGGCGTGAGGGCCAGACACCAAAGGCAGGGCTGAGGGTTTCTGCACCTGAAGTCTCTGTGGGGCACAAGGGCGGCAAGCCAGGCTTGACTATCCAAGCCCCTCAGCTGGAAGTCAGTGTGCCCTCTGCCAATATTGAGGGCCTTGAGGGGAAGCTGAAGGGCCCCCAAATCACTGGGCCATCACTTGAGGGTGACCTAGGCCTGAAAGGTGCCAAGCCACAGGGGCACATTGGGGTGGATGCCTCTGCTCCCCAAATTGGGGGTAGCATCACTGGCCCCAGTGTGGAAGTTCAGGCCCCTGACATTGATGTTCAGGGGCCTGGGAGCAAACTGAATGTGCCCAAGATGAAAGTCCCCAAGTTCTCTGTATCAGGTGCAAAGGGAGAGGAAACTGGGATTGATGTGACACTGCCTACAGGTGAAGTGACTGTTCCTGGGGTCTCTGGGGATGTCAGCCTGCCTGAGATTGCTACTGGTGGGCTGGAAGGAAAGATGAAAGGTACTAAAGTGAAGACTCCTGAAATGATTATTCAGAAACCTAAAATCTCCATGCAGGATGTGGATCTGAGCCTTGGGTCTCCTAAACTGAAAGGAGATATTAAGGTTTCTGCTCCTGGGGTGCAAGGTGATGTTAAAGGCCCTCAAGTGGCACTTAAAGGCTCCAGAGTGGACATAGAGACACCAAACCTAGAGGGAACCTTGACAGGCCCTAGGCTTGGCAGTCCTTCCGGGAAAACCGGAACCTGTAGGATCTCTATGTCAGAAGTAGACTTAAATGTGGCCGCACCTAAAGTGAAAGGGGGTGTAGATGTCACACTCCCCAGAGTAGAAGGGAAAGTCAAAGTCCCTGAAGTTGATGTCAGAGGCCCCAAAGTGGATGTCAGTGCCCCAGATGTCGAAGCGCATGGCCCAGAATGGAACCTGAAAATGCCCAAGATGAAAATGCCCACGTTCAGCACTCCAGGAGCCAAAGGGGAAGGTCCAGATGTTCATATGACTCTACCCAAAGGAGATATCAGTATTTCAGGGCCCAAGGTCAATGTGGAAGCCCCAGATGTCAACTTGGAGGGTCTGGGGGGAAAACTTAAAGGCCCCGATGTTAAGCTGCCTGATATGAGTGTCAAGACACCAAAGATCTCCATGCCTGATGTAGATTTGCACGTGAAAGGTACAAAGGTGAAGGGAGAGTATGATGTAACTGTACCAAAGCTGGAAGGAGAACTCAAAGGCCCA