Transcript asmbl_20245

Sequence
Transcript Sequence for observation asmbl_20245 of TGE0056757:
GCCACTGCACTCCAGCCTGGGCAGTAGAGCAAGACTCTGTCTCATAAATAAATAAGAAAATAAATAAATAAATAAAGGAGGTGATGTGAGTGGTGGGGAGGCTGTGGTGGCAAACACAATATGAGCAAGAAGTCAAAGCCAGCTTTGCATTGGAGCTAGAGGATATTTAGGAATCACACACAGGTATGGGGTTTTGAGAACACAATGCTTTTCTTTGGTTGAAGCCGCACTGATTTGTTTCCTACCTTGGATTTGTACCATTCTTCTGCCTCCTGCAGGTTCTTGGCAGCCACACTTTCATATTGCTGACGTACGTCACGCAGGGCAGCCGTGAGGTCAGGCTTGGAAACATCCACATCGATTTGGACATGCTGTTCCTGAATCTGAGCCTGCAGCTCCTGGATTTCCTGCAAAAAGAACAGACAGACGGTCAGCTCTGCCAACCGTGGGGGCTGCCTTACCCTCATTCATTCCCCGAAAGTCACTCCACTAACCTCTTCGTGGAGTTTCTTCAAAAAGGCAATCTCTTCTTGCAAAGATTCCACTTTGCGTTCAAGGTCAAGACGTGCCAGAGACGCATTGTCAACATCCTATTTTGAACAGAGAAAAGACAGGACATGGAGGATGTAAAAGTGTATGGCTTATCTCATTTATTTGTCTTAGATTAACCATCTGAACCTAGTCTCCTTACTATAGAAAAGCCGTTGACACATTTTATGACCCTGGAATAGGTTTATAAATCATTCAGTGCTATAATATGCTGTGCTTTCTCCTGCTCACTAATATATTTTAATTGTGACTGCTTGTGTTTTACTCAAGGTGGTGATCAGACAATTTTAAAATAAATAAATGTCCACACACATGGTAAACTGCACTCAATCATGACTGAATCCACATTTTACCAGTGATATTTTAAAATTACTTTTTAAGGCTGGTCATGGTGGCTTATGCCTGTAATCC