Transcript asmbl_18887

Sequence
Transcript Sequence for observation asmbl_18887 of TGE0003336:
AGCACAGGCTAGAGGCTGCGCAAGCGCGGGGCCCGCCCCTGGGACCCTCCGGGCCGGGCGGTTTGGCCCCTTAGCGCCCGGGCGTCGGGGCGGTAAAAGGCCGGCAGAAGGGAGGCACTTGAGGTAGGTGCTGCGCGCCGGGGCTCCGCGAGGCACGTGATGTCCGTAGGCGGGGCCTGCCGCGGCGTAGGTGGGGAAACTGAGGCAGTGCAGGGCCGGTAGGGTGGGTGCTGGGCTGGTGAGGCGCGCCCCTCGGGCCCGCGCCAACTTTCTTAGGAGCCGCCGCAGCGCTGGCGCTCCCTCCGAGGACGACGACCCTTCCGCCACCCTGCGTGGCGGCCGATGGAAAAACCCTGCGCCCAGACGTCGGAGAACGGAGACGGGGACCCGGCGCTGCTGCGGCGGGCTAGGGCCCCCTCTGTCCACGCCCGCAAGCCTTGAGTGACGCCGGTGGCGCCAACCTTCGCGAATTGTTGGGACAAAGAACAGAGGAGAGGGCCCTGCCCTGGAGCATGGGCCCGGGGGCCGCCCTGCTGGACCAGCCCCAGAAATGTCTTTCCTCCAGGACCCAAGTTTCTTCACCATGGGGATGTGGTCCATTGGTGCAGGAGCCCTGGGGGCTGCTGCCTTGGCATTGCTGCTTGCCAACACAGACGTGTTTCTGTCCAAGCCCCAGAAAGCGGCCCTGGAGTACCTGGAGGATATAGACCTGAAAACACTGGAGAAGGAACCAAGGACTTTCAAAGCAAAGGAGCTATGGGAAAAAAATGGAGCTGTGATTATGGCCGTGCGGAGGCCAGGCTGTTTCCTCTGTCGAGAGGAAGCTGCGGATCTGTCCTCCCTGAAAAGCATGTTGGACCAGCTGGGCGTCCCCCTCTATGCAGTGGTAAAGGAGCACATCAGGACTGAAGTGAAGGATTTCCAGCCTTATTTCAAAGGAGAAATCTTCCTGGATGAAAAGAAAAAGTTCTATGGTCCACAAAGGCGGAAGATGATGTTTATGGGATTTATCCGTCTGGGAGTGTGGTACAACTTCTTCCGAGCCTGGAACGGAGGCTTCTCTGGAAACCTGGAAGGAGAAGGCTTCATCCTTGGGGGAGTTTTCGTGGTGGGATCAGGAAAGCAGGGCATTCTTCTTGAGCACCGAGAAAAAGAATTTGGAGACAAAGTAAACCTACTTTCTGTTCTGGAAGCTGCTAAGATGATCAAACCACAGACTTTGGCCTCAGAGAAAAAATGATTGTGTGAAACTGCCCAGCTCAGGGATAACCAGGGACATTCACCTGTGTTCATGGGATGTATTGTTTCCACTCGTGTCCCTAAGGAGTGAGAAACCCATTTATACTCTACTCTCAGTATGGATTATTAATGTATTTTAATATTCTGTTTAGGCCCACTAAGGCAAAATAGCCCCAAAACAAGACTGACAAAAATCTGAAAAACTAATGAGGATTATTAAGCTAAAACCTGGGAAATAGGAGGCTTAAAATTGACTGCCAGGCTGGGTGCAGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCAAGGTGA