Transcript asmbl_18885

Sequence
Transcript Sequence for observation asmbl_18885 of TGE0003336:
AGCACAGGCTAGAGGCTGCGCAAGCGCGGGGCCCGCCCCTGGGACCCTCCGGGCCGGGCGGTTTGGCCCCTTAGCGCCCGGGCGTCGGGGCGGTAAAAGGCCGGCAGAAGGGAGGCACTTGAGGTAGGTGCTGCGCGCCGGGGCTCCGCGAGGCACGTGATGTCCGTAGGCGGGGCCTGCCGCGGCGTAGGTGGGGAAACTGAGGCAGTGCAGGGCCGGTAGGGTGGGTGCTGGGCTGGTGAGGCGCGCCCCTCGGGCCCGCGCCAACTTTCTTAGGAGCCGCCGCAGCGCTGGCGCTCCCTCCGAGGACGACGACCCTTCCGCCACCCTGCGTGGCGGCCGATGGAAAAACCCTGCGCCCAGACGTCGGAGAACGGAGACGGGGACCCGGCGCTGCTGCGGCGGGCTAGGGCCCCCTCTGTCCACGCCCGCAAGCCTTGAGTGACGCCGGTGGCGCCAACCTTCGCGAATTGTTGGGACAAAGAACAGAGGAGAGGGCCCTGCCCTGGAGCATGGGCCCGGGGGCCGCCCTGCTGGACCAGCCCCAGGTGCGGACCTGGCAGTCCTCGTCCTCGTCTCTGTGCCCGCTTAGGGTCGTGTCTTTTAAGAGGGCACGGTTTCTAGCGTTGTTCAGCGTTTCGGAGGCACCTGTTCCCCCTCTTTCCCAAGAGTCACAAACGCCTGACTTTAAATTGGGTAGAGCCCAGTTGTAAACTTAACAGCCCTGCTGAGGTCTAGGAATGAAAAGATGAACAATCTGCCCCCAGGGTTGTTGCTGGAGCGGGAGGTGAAGGCGCAGGTGGAGATGGTTAGAGGCAAAGGAAGGGAAGTCAAGGCCCAGCCGGTCCAGGGCTGTGGGAAGGAGGCACACCCGGGAGTCCACTGCCGGACCGGGGTTCCCAGCTGCTCCTGCGCCTCTTTTCCTTGCCACATCATGCTGTCTGCACAGCCCAGCAACCCAGAACTCAGCTTTTTTGTTTGTTTTATTTTAATGTATTTTCCTTTGAACCTGGCAGGTGGTTTTTCAAAAAGAAAATAATCAAGATTTGTTTTGAAAAGCATTGTGAAAAAGTCAGCTTGAATAGTCTTGAATGCTCCTGCTCGGGCCCAGCTTTGGAGAATGAGGATTGGGATTTCCACTGCAGACCCCGACTCGTTACCATACTCATTCATCAGAAAACTCTTCATTTTGTGTACAAATAACGTTTTGAGGCTTTCCATTTAGATGTTTTCTGGAGACTGACTGTTGGCAGCTGAAGGAGCCCCAGGGTTTCTGGGTGGCCTGGTCCTGCCTATGGAGTGACTGAGCCTAGGGACCTAGTCCCGCCTCCAGCCCTCCCCTTGCCGCCTGCCCAGGCCCGTCTGCTCACCCCTGGATATACTTCTTTGTCAAGAGAAGCAGAGGTGTGGACGCTGTGTATGAAATGTCTTTCCTCCAGGACCCAAGTTTCTTCACCATGGGGATGTGGTCCATTGGTGCAGGAGCCCTGGGGGCTGCTGCCTTGGCATTGCTGCTTGCCAACACAGACGTGTTTCTGTCCAAGCCCCAGAAAGCGGCCCTGGAGTACCTGGAGGATATAGACCTGAAAACACTGGAGAAGGAACCAAGGACTTTCAAAGCAAAGGAGCTATGGGAAAAAAATGGAGCTGTGATTATGGCCGTGCGGAGGCCAGGCTGTTTCCTCTGTCGAGAGGAAGCTGCGGATCTGTCCTCCCTGAAAAGCATGTTGGACCAGCTGGGCGTCCCCCTCTATGCAGTGGTAAAGGAGCACATCAGGACTGAAGTGAAGGATTTCCAGCCTTATTTCAAAGGAGAAATCTTCCTGGATGAAAAGAAAAAGTTCTATGGTCCACAAAGGCGGAAGATGATGTTTATGGGATTTATCCGTCTGGGAGTGTGGTACAACTTCTTCCGAGCCTGGAACGGAGGCTTCTCTGGAAACCTGGAAGGAGAAGGCTTCATCCTTGGGGGAGTTTTCGTGGTGGGATCAGGAAAGCAGGGCATTCTTCTTGAGCACCGAGAAAAAGAATTTGGAGACAAAGTAAACCTACTTTCTGTTCTGGAAGCTGCTAAGATGATCAAACCACAGACTTTGGCCTCAGAGAAAAAATGATTGTGTGAAACTGCCCAGCTCAGGGATAACCAGGGACATTCACCTGTGTTCATGGGATGTATTGTTTCCACTCGTGTCCCTAAGGAGTGAGAAACCCATTTATACTCTACTCTCAGTATGGATTATTAATGTATTTTAATATTCTGTTTAGGCCCACTAAGGCAAAATAGCCCCAAAACAAGACTGACAAAAATCTGAAAAACTAATGAGGATTATTAAGCTAAAACCTGGGAAATAGGAGGCTTAAAATTGACTGCCAGGCTGGGTGCAGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCAAGGTGA