Transcript asmbl_18883

Sequence
Transcript Sequence for observation asmbl_18883 of TGE0003336:
AAGGAAACAACATGAGCAACACTTGCTGAAGCCAAGCTGTGGAGGGCCCCATCAGCTGGCTTGCTGAGGAGTTTATTGTTAGTGAGAGTCTGAACACAAGGGAAAGGTGTAATCAGGTGGGGGTGTGCTGGGATCGCTCTGACTACGGCTTGGAAAATAAACTATAGAGGACCAGACTAGAACCAAGCCAGATTCATTCTGTGGTTCTTGAAATAGGCTAGGGACAGAGTTATAGGATCCTGGGTTTGGGCAGCAGCAGTGAGGTCGAGAAGAGGATGGGTAGCAGATACATTTTAGAAGATGGACAGAACTTCCTGAGTCGATGTAGGCAGTGAAGGCAAATGAACAGTAAAATGTGAACCCCTGTCCCCCACTGTCCCCCCTCCCTGCCCCCCCATCTACTGAGCCATGGAACTCCAGCAGAGAAATCGACTTTAGTTTTGGATGTGGTACAACCAAGACACCTACAAAACCCCCAAGTGGAAACTTTGGGTCAGAACAGCAATAGGAACTTGGAAGTCAATAACAAAGTGGTGGGAGAAGTGCTGGAAGTCACCCAGGAAGGGAGTGTGGGTTGAGGGAAGCCACCGATGTGGCAGAAAAGGAAGGGAAAGCAAAAGGAGGTAAAGAATAGACAGCAGATGAGGGGCCTCAGAGGTGCCAGCTGACTTTCCAGGCCTGGGGTGAGGAATGGGGCAAGGGAGCAGGCTGCACGAGGAGCCACAGAGAAAAGGACATCTTCTTTTATTTGCGCTAGTATGACATGTGGGCTGTGTTACGAGCTTTGCTTCTTTAGTCTGCACCGGATAGCAGAGGAGTCTGGTGGCACTTGGGAAATGTTATAATCTGCATGACTGCAAATGACTCAAAGCTTTGCTCAACTTTTTGAAGGGCTAGGGGGCCTTGGCAGCTTTCCATTTAGATGTTTTCTGGAGACTGACTGTTGGCAGCTGAAGGAGCCCCAGGGTTTCTGGGTGGCCTGGTCCTGCCTATGGAGTGACTGAGCCTAGGGACCTAGTCCCGCCTCCAGCCCTCCCCTTGCCGCCTGCCCAGGCCCGTCTGCTCACCCCTGGATATACTTCTTTGTCAAGAGAAGCAGAGGTGTGGACGCTGTGTATGAAATGTCTTTCCTCCAGGACCCAAGTTTCTTCACCATGGGGATGTGGTCCATTGGTGCAGGAGCCCTGGGGGCTGCTGCCTTGGCATTGCTGCTTGCCAACACAGACGTGTTTCTGTCCAAGCCCCAGAAAGCGGCCCTGGAGTACCTGGAGGATATAGACCTGAAAACACTGGAGAAGGAACCAAGGACTTTCAAAGCAAAGGAGCTATGGGAAAAAAATGGAGCTGTGATTATGGCCGTGCGGAGGCCAGGCTGTTTCCTCTGTCGAGAGGAAGCTGCGGATCTGTCCTCCCTGAAAAGCATGTTGGACCAGCTGGGCGTCCCCCTCTATGCAGTGGTAAAGGAGCACATCAGGACTGAAGTGAAGGATTTCCAGCCTTATTTCAAAGGAGAAATCTTCCTGGATGAAAAGAAAAAGTTCTATGGTCCACAAAGGCGGAAGATGATGTTTATGGGATTTATCCGTCTGGGAGTGTGGTACAACTTCTTCCGAGCCTGGAACGGAGGCTTCTCTGGAAACCTGGAAGGAGAAGGCTTCATCCTTGGGGGAGTTTTCGTGGTGGGATCAGGAAAGCAGGGCATTCTTCTTGAGCACCGAGAAAAAGAATTTGGAGACAAAGTAAACCTACTTTCTGTTCTGGAAGCTGCTAAGATGATCAAACCACAGACTTTGGCCTCAGAGAAAAAATGATTGTGTGAAACTGCCCAGCTCAGGGATAACCAGGGACATTCACCTGTGTTCATGGGATGTATTGTTTCCACTCGTGTCCCTAAGGAGTGAGAAACCCATTTATACTCTACTCTCAGTATGGATTATTAATGTATTTTAATATTCTGTTTAGGCCCACTAAGGCAAAATAGCCCCAAAACAAGACTGACAAAAATCTGAAAAACTAATGAGGATTATTAAGCTAAAACCTGGGAAATAGGAGGCTTAAAATTGACTGCCAGGCTGGGTGCAGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCAAGGTGA