Transcript asmbl_18882

Sequence
Transcript Sequence for observation asmbl_18882 of TGE0003336:
CCAGGACCTCCTCTTTCTGATATAACACCTGCATTTGTTTGGCAGACATCTGTGTAGTTCTGTTCACAGGAGAAAAAAGTCAGATTACTAAACACCAGTGTTTAACAGTGGCCATCAGTAGGTGGTAGCTTCAGAGAGTATTTGCTTTCTTATCGACTATGGTTTCATGTATTCTCTGTTTTGTTTTTTACTATAAGCATATTTTGTTTTTATATAAGGGAGAAATAAAGCTCTTCTCAATTGGGAGAAATTACTGCCTGCCTATAATGAATGAGGCCCTGCTGGGCACTGGCTGGGGGCTTGATGAGTAGGATATGGTCCCTGTTTTTGGAGGGTCGTCAAACTAAAGAGGAAAGAAGATAGGGGAACAAAACAGTGCGGTTGGTGTTCTAAGTATCCTCTGATCACAGAAGAGAAAGCTGCCCCTACCCAGGGACATGATCCTGAGCCACCTGGATTGTGAGGGAGAATCAGGCATTGATGAGGAGGGGAATGAGGAAGTAGTCTGCCTACAGGGGACATAGCTCGGCACAGCTCCACAGAGCTAGGGGCTGCAACTTGGGGCATGAGAAGAGAGAGCAGCAAGAGAACCATTTGAGAAGGCTGTCCTTTCTCTGTCATCACTCCTGATGCCCTGGTGAGCTCCACGGTGCAGGAACCTCCATGTGTGTGCTGCATCCCCAAGTTCTGGTGGCAGCAGGTGCTTAGCAGCCCTTGTCCAGTCTCGCCTGTGACACTGCTGCTCCCTTCCCCTGTCCTGACCTCCTGGTTGGCTGTCCTGCCAGAGCCTTGCCTGGAAGATGAAATTCCAGCTACCCTGTGGGAGCAGTAACGCCTTCTTCCTTCTTCTCAATCTCCAGAAATGTCTTTCCTCCAGGACCCAAGTTTCTTCACCATGGGGATGTGGTCCATTGGTGCAGGAGCCCTGGGGGCTGCTGCCTTGGCATTGCTGCTTGCCAACACAGACGTGTTTCTGTCCAAGCCCCAGAAAGCGGCCCTGGAGTACCTGGAGGATATAGACCTGAAAACACTGGAGAAGGAACCAAGGACTTTCAAAGCAAAGGAGCTATGGGAAAAAAATGGAGCTGTGATTATGGCCGTGCGGAGGCCAGGCTGTTTCCTCTGTCGAGAGGAAGCTGCGGATCTGTCCTCCCTGAAAAGCATGTTGGACCAGCTGGGCGTCCCCCTCTATGCAGTGGTAAAGGAGCACATCAGGACTGAAGTGAAGGATTTCCAGCCTTATTTCAAAGGAGAAATCTTCCTGGATGAAAAGAAAAAGTTCTATGGTCCACAAAGGCGGAAGATGATGTTTATGGGATTTATCCGTCTGGGAGTGTGGTACAACTTCTTCCGAGCCTGGAACGGAGGCTTCTCTGGAAACCTGGAAGGAGAAGGCTTCATCCTTGGGGGAGTTTTCGTGGTGGGATCAGGAAAGCAGGGCATTCTTCTTGAGCACCGAGAAAAAGAATTTGGAGACAAAGTAAACCTACTTTCTGTTCTGGAAGCTGCTAAGATGATCAAACCACAGACTTTGGCCTCAGAGAAAAAATGATTGTGTGAAACTGCCCAGCTCAGGGATAACCAGGGACATTCACCTGTGTTCATGGGATGTATTGTTTCCACTCGTGTCCCTAAGGAGTGAGAAACCCATTTATACTCTACTCTCAGTATGGATTATTAATGTATTTTAATATTCTGTTTAGGCCCACTAAGGCAAAATAGCCCCAAAACAAGACTGACAAAAATCTGAAAAACTAATGAGGATTATTAAGCTAAAACCTGGGAAATAGGAGGCTTAAAATTGACTGCCAGGCTGGGTGCAGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCAAGGTGA