Transcript asmbl_18490

Sequence
Transcript Sequence for observation asmbl_18490 of TGE0056140:
TGACGCCCTGCGCCAGGCAAAGCAGGAGTCCACTGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGATGCCCTTAAAGGAACCGTGAGTACCAACCCTGCAGTAAAAGAGGGAAAATAATGACCCATTCTGCTGACTAGGCTCATGATGATACCTGAACAAAATGTTGAGTGAGTAAAAATGTATATCATAATGCAAAGAAAATGAGTTATCAAGACAGACTCAAAAGGGACTTCATGGAACTCTTGAAGGTTTTAGCTTGCCTATATCATTGCTTCTAATATGAAGGACTTGGTACTCGCATTCTCCACCTAAAATTAGAGTGGTCGCCATTTGCCGCTAATGGAAATTATTGCAGAAGGTCTGTAAATGGTTCTGGGAACAGCTGGGTTTTTCTGAGAAATAACACCAGACATCTTTCTCACCCCCTGCAGAATGAGTCCCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCCGTTGAAGCTGCTAACTACCAAGACACTATTGGCCGCCTGCAGGATGAGATTCAGAATATGAAGGAGGAAATGGCTCGTCACCTTCGTGAATACCAAGACCTGCTCAATGTTAAGATGGCCCTTGACATTGAGATTGCCACCTACAGGAAGCTGCTGGAAGGCGAGGAGAGCAGGTAGGGAACTCAGACTTGGATGCGTGAACTAATGGTGACCATTTGTTAGGCCCTGTGCCACTGGGCTCTAAGCAGTGTCACATTTAATCTTTAGAAAGTTTCTTTGAGGTAACTGCTTTCCACTTTTTGTAGAGGAGGAATTTGAATTGAGAGAGAGTAAGTGACTTGCTGAAAAAGGGTTAATCAACAGCAGAGCTGGGATTTGAACCCATAACTCTGTCAAAGCCTCCACTCCTAACTCCTGTTCATGCTCCTGTGGAGAAAATGCTTGTAGTAACATATTTTAAATGTACTAACAAGACCAGTCATGGGAAAATGTTTCTGAGACAAATCTCTAGTTTATGATTTAAAACAGTACGTTTTCTTACGTGACGAAAACAAAAAGTGTGTTAATTTGTTCCCAGTGGTTGAAGTTATTTGCCAACAATTTTACTGTTTCTCTTCATCTGTTTATAGGATTTCTCTGCCTCTTCCAAACTTTTCCTCCCTGAACCTGAGGGGTAAGCATTTTATTTCCCTTTAGGAAAAACGTCAGCTGCTTGTAACCACTGTGTTTATGTCAAAGCATTCATTTTTTTTAGGATATCTGAAAAAATGCCATATAAGAGAAAACTCTATAAAACATCTATAATTTTCGAACCCAAGTACACTCTTGCATTCTATGCTTTAAGTTAAATGCAAACTCCTTTTTCCTTCTTCCTGCTGCAAGTACTATCTCATCCTGATGCTCAAGAGTGTCAGGGCCTGGGTTTCCAAACAGAGACTACCCTAAAATTATTTGGCGAGTAGTACTTTACACAATTGCCTCTCCCCCACAAATCATAATTGTTTCAGTAAAATGGTTACTTGGTTTTTCCAAGAAAAAACTCGTTTTTACTCATTTTTGGCCTGTTTGTTTATTTAGAAACTAATCTGGATTCACTCCCTCTGGTTGATACCCACTCAAAAAGGACACTTCTGATTAAGACGGTTGAAACTAGAGATGGACAGGTTATCAACGAAACTTCTCAGCATCACGATGACCTTGAATAAAAATTGCACACACTCAGTGCAGCAATATATTACCAGCAAGAATAAAAAAGAAATCCATATCTTAAAGAAACAGCTTTCAAGTGCCTTTCTGCAGTTTTTCAGGAGCGCAAGATAGATTTGGAATAGGAATAAGCTCTAGTTCTTAACAACCGACACTCCTACAAGATTTAGAAAAAAGTTTACAACATAATCTAGTTTACAGAAAAATCTTGTGCTAGAATACTTTTTAAAAGGTATTTTGAATACCATTAAAACTGCTTTTTTTTTTCCAGCAAGTATCCAACCAACTTGGTTCTGCTTCAATAAATCTTTGGAAAAACTC