Transcript asmbl_18489

Sequence
Transcript Sequence for observation asmbl_18489 of TGE0056140:
TGACGCCCTGCGCCAGGCAAAGCAGGAGTCCACTGAGTACCGGAGACAGGTGCAGTCCCTCACCTGTGAAGTGGATGCCCTTAAAGGAACCGTGAGTACCAACCCTGCAGTAAAAGAGGGAAAATAATGACCCATTCTGCTGACTAGGCTCATGATGATACCTGAACAAAATGTTGAGTGAGTAAAAATGTATATCATAATGCAAAGAAAATGAGTTATCAAGACAGACTCAAAAGGGACTTCATGGAACTCTTGAAGGTTTTAGCTTGCCTATATCATTGCTTCTAATATGAAGGACTTGGTACTCGCATTCTCCACCTAAAATTAGAGTGGTCGCCATTTGCCGCTAATGGAAATTATTGCAGAAGGTCTGTAAATGGTTCTGGGAACAGCTGGGTTTTTCTGAGAAATAACACCAGACATCTTTCTCACCCCCTGCAGAATGAGTCCCTGGAACGCCAGATGCGTGAAATGGAAGAGAACTTTGCCGTTGAAGCTGCTAACTACCAAGACACTATTGGCCGCCTGCAGGATGAGATTCAGAATATGAAGGAGGAAATGGCTCGTCACCTTCGTGAATACCAAGACCTGCTCAATGTTAAGATGGCCCTTGACATTGAGATTGCCACCTACAGGAAGCTGCTGGAAGGCGAGGAGAGCAGGTAGGGAACTCAGACTTGGATGCGTGAACTAATGGTGACCATTTGTTAGGCCCTGTGCCACTGGGCTCTAAGCAGTGTCACATTTAATCTTTAGAAAGTTTCTTTGAGGTAACTGCTTTCCACTTTTTGTAGAGGAGGAATTTGAATTGAGAGAGAGTAAGTGACTTGCTGAAAAAGGGTTAATCAACAGCAGAGCTGGGATTTGAACCCATAACTCTGTCAAAGCCTCCACTCCTAACTCCTGTTCATGCTCCTGTGGAGAAAATGCTTGTAGTAACATATTTTAAATGTACTAACAAGACCAGTCATGGGAAAATGTTTCTGAGACAAATCTCTAGTTTATGATTTAAAACAGTACGTTTTCTTACGTGACGAAAACAAAAAGTGTGTTAATTTGTTCCCAGTGGTTGAAGTTATTTGCCAACAATTTTACTGTTTCTCTTCATCTGTTTATAGGATTTCTCTGCCTCTTCCAAACTTTTCCTCCCTGAACCTGAGGGAAACTAATCTGGATTCACTCCCTCTGGTTGATACCCACTCAAAAAGGACACTTCTGATTAAGACGGTTGAAACTAGAGATGGACAGGTTATCAACGAAACTTCTCAGCATCACGATGACCTTGAATAAAAATTGCACACACTCAGTGCAGCAATATATTACCAGCAAGAATAAAAAAGAAATCCATATCTTAAAGAAACAGCTTTCAAGTGCCTTTCTGCAGTTTTTCAGGAGCGCAAGATAGATTTGGAATAGGAATAAGCTCTAGTTCTTAACAACCGACACTCCTACAAGATTTAGAAAAAAGTTTACAACATAATCTAGTTTACAGAAAAATCTTGTGCTAGAATACTTTTTAAAAGGTATTTTGAATACCATTAAAACTGCTTTTTTTTTTCCAGCAAGTATCCAACCAACTTGGTTCTGCTTCAATAAATCTTTGGAAAAACTC