Transcript asmbl_18042

Sequence
Transcript Sequence for observation asmbl_18042 of TGE0058614:
CGAGTGGGCGGGGCCGGCTGTTGGCGGCGGTTGGCTCGGCGCGGGAGTCGGCTGCACGTGCGGGCGGGGGCGATGCGTCACTGATCGGAGGAACGAGAATGAATATGACTCAAGCCCGGGTTCTGGTGGCTGCAGTGGTGGGGTTGGTGGCTGTCCTGCTCTACGCCTCCATCCACAAGATTGAGGAGGGCCATCTGGCTGTGTACTACAGGGGAGGAGCTTTACTAACTAGCCCCAGTGGACCAGGCTATCATATCATGTTGCCTTTCATTACTACGTTCAGATCTGTGCAGACAACACTACAAACTGATGAAGTTAAAAATGTGCCTTGTGGAACAAGTGGTGGGGTCATGATCTATATTGACCGAATAGAAGTGGTTAATATGTTGGCTCCTTATGCAGTGTTTGATATCGTGAGGAACTATACTGCAGATTATGACAAGACCTTAATCTTCAATAAAATCCACCATGAGCTGAACCAGTTCTGCAGTGCCCACACACTTCAGGAAGTTTACATTGAATTGTTTGATCAAATAGATGAAAACCTGAAGCAAGCTCTGCAGAAAGACTTAAACCTCATGGCCCCAGGTCTCACTATACAGGCTGTGCGTGTTACAAAACCCAAAATCCCAGAAGCCATAAGAAGAAATTTTGAGTTAATGGAGGCTGAGAAGACAAAACTCCTTATAGCTGCACAGAAACAAAAGGTTGTGGAAAAAGAAGCTGAGACAGAGAGGAAAAAGGCAGTTATAGAAGCAGAGAAGATTGCACAAGTGGCAAAAATTCGGTTTCAGCAGAAAGTGATGGAAAAAGAAACTGAAAAGCGCATTTCTGAAATCGAAGATGCTGCATTCCTGGCCCGAGAGAAAGCGAAAGCAGATGCTGAATATTATGCTGCACACAAATATGCCACCTCAAACAAGCACAAGTTGACCCCGGAATATCTGGAGCTCAAAAAGTACCAGGCCATTGCTTCTAACAGTAAGATCTATTTTGGCAGCAACATCCCTAACATGTTCGTGGACTCCTCATGTGCTTTGAAATATTCAGATATTAGGACTGGAAGAGAAAGCTCACTCCCCTCTAAGGAGGCTCTTGAACCCTCTGGAGAGAACGTCATCCAAAACAAAGAGAGCACAGGTTGATGCAAGAGGTGGAAATGTTCTCCATATCAAGATGTGGCCCAAGGGGTTAAGTGGGAACAATCATTATACGGACTCTTCAGATTTACAGAGAACTTACACTTCATCTGTTCCACCTCTCCTGCGATAGTCCTGGGTGCTCCACTGATTGGAGGATAGAGCCAGCTGTCTGACACACAAATGGTCTTTTCAGCCACAGTCTTATCAAGTATCCTATATGTATTCCTTTCTAAACTGCTACTCATGAATGAGGAAAGTCTGATGCTAAGATACTGCCTGCACTGGAATGTTAAACACTAAATATATAACAAGCTGTGTTTTCCTAAGCTGAGATCTGTTGAATAATGTTTACATTCGTCCCCCGGGGAAATGTATGCTCAGCCACCATTCAAGAGATGACTGAGAAGGAGATGGTAAGTTCAAGAAGACTGATTGCACCTGGGACCCAGGCCCTTTCTTTGGGATCCAGTCCCAGCCTTCATCCATGTGATTAAGATCCAGGCCGCTGAAGTTCCCCAGGAAATGATCTTCCACTTGAGCAACCTTTTACTTGATACGATTTGCACCTTTCTGTTTTCCTGCAGTCAGGGTGGTGGCCTGCAGGGACCTGAGCTTTGCTACCCAACCAGATTCCTCATAGAGATTCCTAATCACTAGTTTCTTGTATTCATAAACTCAGAGATACAGAGGGCTTGGTTTGAAGTTGGGGTGAGATGAAACCTTTGCTCTGAGCCAAAGCTCTGGGGCCTTGCATTCCCTGCATTGGGTTGATGACTGTCAGCATCACTGCCGCAGGCCATGCTTGACTAAGGTACCTGGTTTTAGCCACAGCCACCTCCTTGTATGTTACCTTTCAGCTCTGGCCAAGAGTGGGACAGGGTTTTAACCACAAATAGGAGCAGCATGCAATTCCTAGTGACTTGCTGCACAGTATTGTATCATAATTACAGGAAGTTTTTATTTTTAAAACTGGATCTGGGGTATATTCATTTGCCCCATCACCTCTGTCTAAAGGCCCAAGTCCTAGGGCTGCCATGGTCACAAGCACACTGATGCTCCTTAAGATTGTTTATCTGGAGCCCACATAGTGTGGAACAAAAAGTCACCTAGAAAGCATCCTTGGTCATCATTGTCTCCTTCCCACCTGGCCCAGAGATGCTTAAATCCAAGTTGTTTCTCCAGCTGTCACCTCCCCCAGGAGATCAGGATTCCACTGACGTCCTGGGCAGCCAGTGAATTTAATTTTCCATGAGAAACAACAGAGTTAACCTGTGGCATTAGGAGACCTACTTCATGTGGACCCTTTTTTTCCTTCAGTTTAACTTTTCTGGAGCAGTGTGCTGCGTAGTTCGGCCTGAGTTTGTGCAGCTTGTTAAGACAACTCTTGTGTACGCTATGTTGAAGCTCAACAAAAAAGTCATGGGACCACTTCTAGAAATCTTTCAGCTGTCAGGCCTGTCAGTCTCATGACAGTTTGTTGGTTGTGCCAAACACTTTATTTGGGAAAGGAAAGCCCAGATTTGAATGGGTCTTTCCCCTGGGCCTTATCCTATAGAGGCATTTGTAATATGGAGAAAATAATTTTTCATTTTTGCTCATTTAATTCTATAAATTCTCTTTATAAATGAATTTTGTGTTCTTTAGTTCTCCTTAAAAGAACTTTTGAATTATAAAAATAAAATCTTTACCTGTCGAATTGTTGCTGCAGATGATTGTTGTGGAAAATCTGGATCATTGACCTCTGTGCTTTCATTCCTAGAGATGTTTTATAGTTACATGAGCAAAAGCTGTTGCCCCAAAGTGATGGCCCTGGAGGCGGGGCTGAGGAACAGGGAAATGCCGCTGTGAAGTCTTAAAGCACTTCTGCTTAAACTCCCATGTGTGAGGAGTGTGCCTCCCTGTGCCCTCTCAGCTCTGAGGCTGGCCGTCTTTCGGGGTGTTCCTTTTGGCAAATATACACTGTAATCTTGAGTCTAAATTTATATGTTGAAATGCTACCTTTTTTAAAATAAGAAACTAAATAAAATTATTTTACTATCA