Transcript asmbl_17956

Sequence
Transcript Sequence for observation asmbl_17956 of TGE0058613:
AGAAAAACAGAGCGGGGCCAGCTGCAGCGTGTAGTGCGAGTGGGGCGGACGCGCGCAGCCCGCCCGCCCGGCGACCAGCAAGGAGTTGGCATCCTTTGGAAGAGTTCGTGAAAGCTTTCTGCCCAGAGCTCCTGGACCAATGCATCTTCCCACCACCTTAAACCACTGAGCAGTTCAGAGCCCCAGTTGCAGACGACTTGTCCTGCCACCACCATGAGTTCTGAATGTGATGGTGGTTCCAAAGCTGTGATGAATGGCTTGGCACCTGGCAGCAATGGGCAAGACAAAGCAACTGCCGACCCTTTACGCGCACGCTCTATTTCTGCTGTTAAAATCATTCCTGTGAAGACAGTGAAAAACGCCTCAGGCCTAGTTCTCCCTACAGACATGGATCTTACAAAAATCTGCACTGGGAAGGGAGCGGTGACTCTCCGGGCCTCGTCTTCCTACAGGGAAACCCCAAGCAGTAGCCCTGCGAGCCCTCAGGAAACCCGGCAACACGAAAGCAAACCAGATGAGTGGAGGCTTTCTTCCAGTGCTGATGCCAATGGAAATGCCCAGCCCTCTTCACTCGCTGCCAAGGGCTACAGAAGTGTGCATCCCAACCTTCCTTCTGACAAGTCCCAGGATTCCAGTCCTCTACTAAATGAAGTTTCTTCTTCCCTTATTGGAACTGATTCCCAAGCCTTTCCATCAGTTAGCAAGCCTTCATCCGCCTATCCCTCCACAACGATTGTCAATCCTACTATTGTGCTCTTGCAACACAATCGAGAACAGCAAAAACGACTCAGTAGCCTTTCAGATCCTGTCTCAGAAAGAAGAGTGGGAGAGCAGGACTCAGCACCAACCCAGGAAAAACCCACCTCACCTGGCAAGGCTATTGAAAAAAGAGCAAAGGATGACAGTAGGCGGGTGGTGAAGAGCACTCAGGACTTAAGCGATGTTTCCATGGATGAAGTGGGCATCCCACTCCGGAACACTGAGAGATCAAAAGACTGGTACAAGACTATGTTTAAACAGATCCACAAACTGAACAGAGATGATGATTCAGATCTGTACTCTCCCAGATACTCATTTTCTGAAGACACAAAATCTCCCCTTTCTGTGCCTCGCTCAAAAAGTGAGATGAGCTACATTGATGGTGAGAAGGTAGTCAAGAGGTCGGCCACACTACCCCTCCCAGCCCGCTCTTCCTCACTGAAGTCAAGCTCAGAAAGAAATGACTGGGAACCCCCAGATAAGAAAGTAGACACAAGAAAATATCGTGCAGAGCCCAAGAGCATTTACGAATATCAGCCTGGCAAGTCTTCCGTTCTGACCAACGAAAAGATGAGTCGGGATATAAGCCCAGAAGAGATAGATTTAAAGAATGAACCTTGGTATAAATTCTTTTCGGAATTGGAGTTTGGGAAACCGAGCTCAGCCATCAGCCCTACTCCGGAAATTTCTTCAGAGACTCCTGGATATATATATTCTTCCAACTTCCATGCAGTGAAGAGGGAATCAGACGGGGCTCCTGGGGATCTCACTAGCTTGGAGAATGAGAGACAAATTTATAAAAGTGTCTTGGAAGGTGGTGACATCCCTCTTCAGGGCCTGAGTGGGCTCAAGCGACCATCCAGCTCTGCTTCCACTAAAGATTCAGAATCGCCAAGACATTTTATACCAGCTGATTACTTGGAATCCACGGAAGAATTTATTCGAAGACGTCATGATGATAAAGAGAAACTTTTAGCGGACCAGAGACGACTTAAACGCGAGCAAGAAGAGGCTGATATTGCAGCTCGACGCCACACAGGCGTCATTCCGACGCACCATCAGTTTATCACTAATGAGCGCTTTGGGGACCTCCTCAATATAGACGATACTGCAAAAAGGAAATCTGGGTCAGAGATGAGACCTGCCAGAGCCAAATTTGACTTTAAAGCTCAGACACTAAAGGAGCTTCCTCTGCAGAAGGGAGATATTGTTTACATTTATAAGCAAATTGATCAGAACTGGTATGAAGGAGAACACCACGGCCGGGTGGGAATCTTCCCACGCACCTACATCGAGCTTCTTCCTCCTGCTGAGAAGGCACAGCCCAAAAAGTTGACACCAGTGCAGGTTTTGGAATATGGAGAAGCTATTGCTAAGTTTAACTTTAATGGTGATACACAAGTAGAAATGTCCTTCAGAAAGGGTGAGAGGATCACACTGCTCCGGCAGGTAGATGAGAACTGGTACGAAGGGAGGATCCCGGGGACATCCCGACAAGGCATCTTCCCCATCACCTACGTGGATGTGATCAAGCGACCACTGGTGAAAAACCCTGTGGATTACATGGACCTGCCTTTCTCCTCCTCCCCAAGTCGCAGTGCCACTGCAAGCCCACAGCAACCTCAAGCCCAGCAGCGAAGAGTCACCCCCGACAGGAGTCAAACCTCACAAGATTTATTTAGCTATCAAGCATTATATAGCTATATACCACAGAATGATGATGAGTTGGAACTCCGCGATGGAGATATCGTTGATGTCATGGAAAAATGTGACGATGGATGGTTTGTTGGTACTTCAAGAAGGACAAAGCAGTTTGGTACTTTTCCAGGCAACTATGTAAAACCTTTGTATCTATAAGAAGACTGAAAACCATGGAGATTATTTTTATTGGAGGAGGAAGCATCATTCATGAACCGATCTTTTTAGTTGAGTCAGTAGGAAAATTAATACAGTGGATAAAGTAAGAAGCAAAAGACAGGGACAGAGAAGTGTTGTGTTTAAAACCCAAGCCTGTCTAAGGTTACTGTGTATTAGACAGGGCCGAACTAGTGTGCTGAGCAAAAAGAATTGAAGCAAATTGTATTTACTTAGCCGCTTCTGGGAGCCACTTCAGCCTTTCCCCTCCCCTCCACTTCTTGGGTAATCTGACCTGAAGCATAGTCCAGGAGCAGAGTTAGCCAGAAATGCCTCCTGCTGCCCCAGCCTTAGAGAGCTCCCATCTCAATCATTGAGCCTGAAGGCTTCAAGCCCAAGAATGCAACAAGACCCCCAGCCTACATTTCTCAGCTCCCCTGGAGCCAGCTGATCCTGTAACGCTGCTGGAGGTCAGTCTGAGCTACCAAGACTGTCCCTAGACAAAGGTGGAGTCCCCCACACTGCCCAAGACCAAATCCCTCACTCAACCTGCTGAGGTGTGGATGGGGAAACAGAGGCAAAACTGAGGCACCTGATGCATTCAGCCTGCTGTGCAGCAGTGCCATTGACTGCCCTGATGTTCAGAGAGAAACGCACACAAGGTTTGCCCATGAGAATTGGGGAGCAGATGGCCAAGCAGATAGGTTATGTCTGTTTTCTGAGTGATGAAGTCAGGAAGCCCTGTGGCTCTGGAGGCCACTTGTGGTTCATTCTTTTCCCATATCCTTGGCTTTTAGAAATGGTTACCTTCAGGACAGTGCAGCTGCATTTATCAGAGCACTATTGCTAAGTTTTCTTTTCTGGCTTGTGTTTTTCTGGGACAGTTTAGAATTGGGAGGCCTATTCTCATAGAACACCAAAAATGATGTTCAGTGATTCATTTAACATACACCAATGTACTCTGGCTGCTGGGGGGACAACCATAAGCAAGACATGCCCAGGGTTTGCCGTGGCTCCAGATCTACTCCCTGTAGGAGTTCAAGGATCACACAAACGGTAGTAACCAGGGTTGTGAATCTGAGTACACCCTGGCAAGGCTTCTCTTCAGACTGAAGCAGCAATTCTGCCACTACCAGCAGCAACCAGGACGTCTGTTCTTTGTGGGGGCCAGATCAGAAGAGAGAGGCCCCTGTGACGCCCGGGCTGCTTGGTCACAACTCTGTCCAATTCAAGGATGTTTATCGGCCTCTCTTAGATCCTGAGTGAGACAAATACAGAAATGACCCATTCCCTGCCCACCAGAAACTCAGAGGTGATTGGGGAGACTGACACAGGAAAATGAACTTAATCAAGAGAGACTGTGATATGTGCTAAGAAGGGTGTGAGGGAGGGAGAGATGAATTTTCCCTGGAGGGATCCTAGAAAGCATTGTCATATTGCCATCTCCATTAGCTCACTTTTAAACAACTAGGGTGCTGGAAGAACCTTTGTCTGAGGGTAGTTCATAGCTGGAAATACTTGGAATATTTTCCAGAGTCTCTAAACTCTCATCTTCCCCCACAGATACACATCCAAGCTCACAAATAGGAGTAGCAATTCTAGGTGGTAGGGTTGTGTACGGAACCCCTGGCTGTCTGCATATATCTCAGAATTACCCCAGGACCATTGTCCCAAAGTCTAGAGTCTTTACAGGTAGGCAAAATTTGTTTTCAATGCCTGTGCCTCAGCTGCTGTCACAAATACCCATCTTAGGATCCCATCAGCTTCCCATCCCCCACCAGACAGCCACAGTACCCTCACTTTCTCCCTATTGTTCTTTCAAATCCTGTTCTCAGGAAAGAAACTGCCACTAATTCATTCACACTAAGGTGTAAATGATTGATAATAGGAATGAGTTACCTCTTCCCACAGACATTTGTTTTTAAGTATGACAGAGCAGGGCCTTAATCCCAAGGGAAAAGGTTATGGAACTGGAGGGGGTGAGCTTTCTGGGTAGAAGGAGACTTCCTGAATTTCCTTAAAACCCAGTAAGAGTAAGACCTGTTGTTTTGGAAGGTCTGCTCCACCATCTAAGAGCACTGTT