Transcript asmbl_17955

Sequence
Transcript Sequence for observation asmbl_17955 of TGE0056138:
CACCTCTCGGTGATGTCACTCAAGACACCACCTCTAGGCATCCCCAGGTTGTGGTGTCAAAATGGTCTGTCTCAGTGCTTCTTCCTCATTCCTAGAAGAGATTGCACTAAGGCAAGGATTTAAAGAGGTGCATCTTCTCAGGCACAGCTGTAGTTGAGTTAAAATAATTCTCTACTGGCCTTACAGGATTTGTAAGAATAGCTTTGTTTTGTTTGAGTTCAAGCAAATAATTCTATTGTGAAGATGCTTGGCCGGGATCTGTGCCTCCTGCCCCAGACTCCAGCCAGTACTGCCCAGGGGAGAGTCTGAGTCGTTCTCCTAATGAGAGCTTCCCAGGAGATCTCCGCCTAGCAAGTGCAAAAGGCATTGACTGGCCTGTGGGACAGTTAAGAAACGGTAGCAGTTACTCCCTTTCCACCTTCACGGCCCAGGAGTTCGATAGCAGATGAAGACGATGATGATTCAGATCTGTACTCTCCCAGATACTCATTTTCTGAAGACACAAAATCTCCCCTTTCTGTGCCTCGCTCAAAAAGTGAGATGAGCTACATTGATGGTGAGAAGGTAGTCAAGAGGTCGGCCACACTACCCCTCCCAGCCCGCTCTTCCTCACTGAAGTCAAGCTCAGAAAGAAATGACTGGGAACCCCCAGATAAGAAAGTAGACACAAGAAAATATCGTGCAGAGCCCAAGAGCATTTACGAATATCAGCCTGGCAAGTCTTCCGTTCTGACCAACGAAAAGATGAGTCGGGATATAAGCCCAGAAGAGATAGATTTAAAGAATGAACCTTGGTATAAATTCTTTTCGGAATTGGAGTTTGGGAAACCGAGCTCAGCCATCAGCCCTACTCCGGAAATTTCTTCAGAGACTCCTGGATATATATATTCTTCCAACTTCCATGCAGTGAAGAGGGAATCAGACGGGGCTCCTGGGGATCTCACTAGCTTGGAGAATGAGAGACAAATTTATAAAAGTGTCTTGGAAGGTGGTGACATCCCTCTTCAGGGCCTGAGTGGGCTCAAGCGACCATCCAGCTCTGCTTCCACTAAAGATTCAGAATCGCCAAGACATTTTATACCAGCTGATTACTTGGAATCCACGGAAGAATTTATTCGAAGACGTCATGATGATAAAGAGAAACTTTTAGCGGACCAGAGACGACTTAAACGCGAGCAAGAAGAGGCTGATATTGCAGCTCGACGCCACACAGGCGTCATTCCGACGCACCATCAGTTTATCACTAATGAGCGCTTTGGGGACCTCCTCAATATAGACGATACTGCAAAAAGGAAATCTGGGTCAGAGATGAGACCTGCCAGAGCCAAATTTGACTTTAAAGCTCAGACACTAAAGGAGCTTCCTCTGCAGAAGGGAGATATTGTTTACATTTATAAGCAAATTGATCAGAACTGGTATGAAGGAGAACACCACGGCCGGGTGGGAATCTTCCCACGCACCTACATCGAGCTTCTTCCTCCTGCTGAGAAGGCACAGCCCAAAAAGTTGACACCAGTGCAGGTTTTGGAATATGGAGAAGCTATTGCTAAGTTTAACTTTAATGGTGATACACAAGTAGAAATGTCCTTCAGAAAGGGTGAGAGGATCACACTGCTCCGGCAGGTAGATGAGAACTGGTACGAAGGGAGGATCCCGGGGACATCCCGACAAGGCATCTTCCCCATCACCTACGTGGATGTGATCAAGCGACCACTGGTGAAAAACCCTGTGGATTACATGGACCTGCCTTTCTCCTCCTCCCCAAGTCGCAGTGCCACTGCAAGCCCACAGCAACCTCAAGCCCAGCAGCGAAGAGTCACCCCCGACAGGAGTCAAACCTCACAAGATTTATTTAGCTATCAAGCATTATATAGCTATATACCACAGAATGATGATGAGTTGGAACTCCGCGATGGAGATATCGTTGATGTCATGGAAAAATGTGACGATGGATGGTTTGTTGGTACTTCAAGAAGGACAAAGCAGTTTGGTACTTTTCCAGGCAACTATGTAAAACCTTTGTATCTATAAGAAGACTGAAAACCATGGAGATTATTTTTATTGGAGGAGGAAGCATCATTCATGAACCGATCTTTTTAGTTGAGTCAGTAGGAAAATTAATACAGTGGATAAAGTAAGAAGCAAAAGACAGGGACAGAGAAGTGTTGTGTTTAAAACCCAAGCCTGTCTAAGGTTACTGTGTATTAGACAGGGCCGAACTAGTGTGCTGAGCAAAAAGAATTGAAGCAAATTGTATTTACTTAGCCGCTTCTGGGAGCCACTTCAGCCTTTCCCCTCCCCTCCACTTCTTGGGTAATCTGACCTGAAGCATAGTCCAGGAGCAGAGTTAGCCAGAAATGCCTCCTGCTGCCCCAGCCTTAGAGAGCTCCCATCTCAATCATTGAGCCTGAAGGCTTCAAGCCCAAGAATGCAACAAGACCCCCAGCCTACATTTCTCAGCTCCCCTGGAGCCAGCTGATCCTGTAACGCTGCTGGAGGTCAGTCTGAGCTACCAAGACTGTCCCTAGACAAAGGTGGAGTCCCCCACACTGCCCAAGACCAAATCCCTCACTCAACCTGCTGAGGTGTGGATGGGGAAACAGAGGCAAAACTGAGGCACCTGATGCATTCAGCCTGCTGTGCAGCAGTGCCATTGACTGCCCTGATGTTCAGAGAGAAACGCACACAAGGTTTGCCCATGAGAATTGGGGAGCAGATGGCCAAGCAGATAGGTTATGTCTGTTTTCTGAGTGATGAAGTCAGGAAGCCCTGTGGCTCTGGAGGCCACTTGTGGTTCATTCTTTTCCCATATCCTTGGCTTTTAGAAATGGTTACCTTCAGGACAGTGCAGCTGCATTTATCAGAGCACTATTGCTAAGTTTTCTTTTCTGGCTTGTGTTTTTCTGGGACAGTTTAGAATTGGGAGGCCTATTCTCATAGAACACCAAAAATGATGTTCAGTGATTCATTTAACATACACCAATGTACTCTGGCTGCTGGGGGGACAACCATAAGCAAGACATGCCCAGGGTTTGCCGTGGCTCCAGATCTACTCCCTGTAGGAGTTCAAGGATCACACAAACGGTAGTAACCAGGGTTGTGAATCTGAGTACACCCTGGCAAGGCTTCTCTTCAGACTGAAGCAGCAATTCTGCCACTACCAGCAGCAACCAGGACGTCTGTTCTTTGTGGGGGCCAGATCAGAAGAGAGAGGCCCCTGTGACGCCCGGGCTGCTTGGTCACAACTCTGTCCAATTCAAGGATGTTTATCGGCCTCTCTTAGATCCTGAGTGAGACAAATACAGAAATGACCCATTCCCTGCCCACCAGAAACTCAGAGGTGATTGGGGAGACTGACACAGGAAAATGAACTTAATCAAGAGAGACTGTGATATGTGCTAAGAAGGGTGTGAGGGAGGGAGAGATGAATTTTCCCTGGAGGGATCCTAGAAAGCATTGTCATATTGCCATCTCCATTAGCTCACTTTTAAACAACTAGGGTGCTGGAAGAACCTTTGTCTGAGGGTAGTTCATAGCTGGAAATACTTGGAATATTTTCCAGAGTCTCTAAACTCTCATCTTCCCCCACAGATACACATCCAAGCTCACAAATAGGAGTAGCAATTCTAGGTGGTAGGGTTGTGTACGGAACCCCTGGCTGTCTGCATATATCTCAGAATTACCCCAGGACCATTGTCCCAAAGTCTAGAGTCTTTACAGGTAGGCAAAATTTGTTTTCAATGCCTGTGCCTCAGCTGCTGTCACAAATACCCATCTTAGGATCCCATCAGCTTCCCATCCCCCACCAGACAGCCACAGTACCCTCACTTTCTCCCTATTGTTCTTTCAAATCCTGTTCTCAGGAAAGAAACTGCCACTAATTCATTCACACTAAGGTGTAAATGATTGATAATAGGAATGAGTTACCTCTTCCCACAGACATTTGTTTTTAAGTATGACAGAGCAGGGCCTTAATCCCAAGGGAAAAGGTTATGGAACTGGAGGGGGTGAGCTTTCTGGGTAGAAGGAGACTTCCTGAATTTCCTTAAAACCCAGTAAGAGTAAGACCTGTTGTTTTGGAAGGTCTGCTCCACCATCTAAGAGCACTGTT