Transcript asmbl_17954

Sequence
Transcript Sequence for observation asmbl_17954 of TGE0058612:
CTCAGCCATCAGCCCTACTCCGGAAATTTCTTCAGAGACTCCTGGATATATATATTCTTCCAACTTCCATGCAGTGAAGAGGGAATCAGACGGGGCTCCTGGGGATCTCACTAGCTTGGAGAATGAGAGACAAATTTATAAAAGTGTCTTGGAAGGTGGTGACATCCCTCTTCAGGGCCTGAGTGGGCTCAAGCGACCATCCAGCTCTGCTTCCACTAAAGATTCAGAATCGCCAAGACATTTTATACCAGCTGATTACTTGGAATCCACGGAAGAATTTATTCGAAGACGTCATGATGATAAAGAGATGAGACCTGCCAGAGCCAAATTTGACTTTAAAGCTCAGACACTAAAGGAGCTTCCTCTGCAGAAGGGAGATATTGTTTACATTTATAAGCAAATTGATCAGAACTGGTATGAAGGAGAACACCACGGCCGGGTGGGAATCTTCCCACGCACCTACATCGAGCTTCTTCCTCCTGCTGAGAAGGCACAGCCCAAAAAGTTGACACCAGTGCAGGTTTTGGAATATGGAGAAGCTATTGCTAAGTTTAACTTTAATGGTGATACACAAGTAGAAATGTCCTTCAGAAAGGGTGAGAGGATCACACTGCTCCGGCAGGTAGATGAGAACTGGTACGAAGGGAGGATCCCGGGGACATCCCGACAAGGCATCTTCCCCATCACCTACGTGGATGTGATCAAGCGACCACTGGTGAAAAACCCTGTGGATTACATGGACCTGCCTTTCTCCTCCTCCCCAAGTCGCAGTGCCACTGCAAGCCCACAGCAACCTCAAGCCCAGCAGCGAAGAGTCACCCCCGACAGGAGTCAAACCTCACAAGATTTATTTAGCTATCAAGCATTATATAGCTATATACCACAGAATGATGATGAGTTGGAACTCCGCGATGGAGATATCGTTGATGTCATGGAAAAATGTGACGATGGATGGTTTGTTGGTACTTCAAGAAGGACAAAGCAGTTTGGTACTTTTCCAGGCAACTATGTAAAACCTTTGTATCTATAAGAAGACTGAAAACCATGGAGATTATTTTTATTGGAGGAGGAAGCATCATTCATGAACCGATCTTTTTAGTTGAGTCAGTAGGAAAATTAATACAGTGGATAAAGTAAGAAGCAAAAGACAGGGACAGAGAAGTGTTGTGTTTAAAACCCAAGCCTGTCTAAGGTTACTGTGTATTAGACAGGGCCGAACTAGTGTGCTGAGCAAAAAGAATTGAAGCAAATTGTATTTACTTAGCCGCTTCTGGGAGCCACTTCAGCCTTTCCCCTCCCCTCCACTTCTTGGGTAATCTGACCTGAAGCATAGTCCAGGAGCAGAGTTAGCCAGAAATGCCTCCTGCTGCCCCAGCCTTAGAGAGCTCCCATCTCAATCATTGAGCCTGAAGGCTTCAAGCCCAAGAATGCAACAAGACCCCCAGCCTACATTTCTCAGCTCCCCTGGAGCCAGCTGATCCTGTAACGCTGCTGGAGGTCAGTCTGAGCTACCAAGACTGTCCCTAGACAAAGGTGGAGTCCCCCACACTGCCCAAGACCAAATCCCTCACTCAACCTGCTGAGGTGTGGATGGGGAAACAGAGGCAAAACTGAGGCACCTGATGCATTCAGCCTGCTGTGCAGCAGTGCCATTGACTGCCCTGATGTTCAGAGAGAAACGCACACAAGGTTTGCCCATGAGAATTGGGGAGCAGATGGCCAAGCAGATAGGTTATGTCTGTTTTCTGAGTGATGAAGTCAGGAAGCCCTGTGGCTCTGGAGGCCACTTGTGGTTCATTCTTTTCCCATATCCTTGGCTTTTAGAAATGGTTACCTTCAGGACAGTGCAGCTGCATTTATCAGAGCACTATTGCTAAGTTTTCTTTTCTGGCTTGTGTTTTTCTGGGACAGTTTAGAATTGGGAGGCCTATTCTCATAGAACACCAAAAATGATGTTCAGTGATTCATTTAACATACACCAATGTACTCTGGCTGCTGGGGGGACAACCATAAGCAAGACATGCCCAGGGTTTGCCGTGGCTCCAGATCTACTCCCTGTAGGAGTTCAAGGATCACACAAACGGTAGTAACCAGGGTTGTGAATCTGAGTACACCCTGGCAAGGCTTCTCTTCAGACTGAAGCAGCAATTCTGCCACTACCAGCAGCAACCAGGACGTCTGTTCTTTGTGGGGGCCAGATCAGAAGAGAGAGGCCCCTGTGACGCCCGGGCTGCTTGGTCACAACTCTGTCCAATTCAAGGATGTTTATCGGCCTCTCTTAGATCCTGAGTGAGACAAATACAGAAATGACCCATTCCCTGCCCACCAGAAACTCAGAGGTGATTGGGGAGACTGACACAGGAAAATGAACTTAATCAAGAGAGACTGTGATATGTGCTAAGAAGGGTGTGAGGGAGGGAGAGATGAATTTTCCCTGGAGGGATCCTAGAAAGCATTGTCATATTGCCATCTCCATTAGCTCACTTTTAAACAACTAGGGTGCTGGAAGAACCTTTGTCTGAGGGTAGTTCATAGCTGGAAATACTTGGAATATTTTCCAGAGTCTCTAAACTCTCATCTTCCCCCACAGATACACATCCAAGCTCACAAATAGGAGTAGCAATTCTAGGTGGTAGGGTTGTGTACGGAACCCCTGGCTGTCTGCATATATCTCAGAATTACCCCAGGACCATTGTCCCAAAGTCTAGAGTCTTTACAGGTAGGCAAAATTTGTTTTCAATGCCTGTGCCTCAGCTGCTGTCACAAATACCCATCTTAGGATCCCATCAGCTTCCCATCCCCCACCAGACAGCCACAGTACCCTCACTTTCTCCCTATTGTTCTTTCAAATCCTGTTCTCAGGAAAGAAACTGCCACTAATTCATTCACACTAAGGTGTAAATGATTGATAATAGGAATGAGTTACCTCTTCCCACAGACATTTGTTTTTAAGTATGACAGAGCAGGGCCTTAATCCCAAGGGAAAAGGTTATGGAACTGGAGGGGGTGAGCTTTCTGGGTAGAAGGAGACTTCCTGAATTTCCTTAAAACCCAGTAAGAGTAAGACCTGTTGTTTTGGAAGGTCTGCTCCACCATCTAAGAGCACTGTT