Transcript asmbl_17952

Sequence
Transcript Sequence for observation asmbl_17952 of TGE0058611:
ATGAGTGGAGGCTTTCTTCCAGTGCTGATGCCAATGGAAATGCCCAGCCCTCTTCACTCGCTGCCAAGGGCTACAGAAGTGTGCATCCCAACCTTCCTTCTGACAAGTCCCAGGTTCTCTCTCCCCCACGCCCTCCTCTCCCTCAAAAGGACCGCTTTGCATGGCAGTCCCCCACCATCCACAATACCTATAAGGATTCCCTCTACCTGAGCTCACCAAAGCCTTATGTCCCACTCGGCACCCCCAGACAGCAGAACCCCTCACAACCCCAGCCTATCTCTGTCCTCCTGGCAGCTGGATCGGCTCCCAAAGGTGTGGTGTGCCCTGGTTCCTTGCTTCCGGACTCCACGTTCCCCAGTGCTTCATCCCAACCCCAGCAGCGCTATGCAGCCACCAGGACAGTTTATCATAAGAATGTGAGCTCTAACCCATGTCATGAGGCAGTTGGGATTAAAAAGGTCAGCAGCTTATATGTACCTTGTTTATCCAATAACATTTGCCTGGCGGCGTCAGAAAACTCCTCTCGTGTTGCACGTGACCCTGCCGAAGGCACTCCCTTGGAGGCTGCGGGCACCCGAGCACCGGCTCCCGGCCTTGTCTCCCGCACAGCCGGCACAGGAAAACCACCCCCTGCTCCTCCTCCTGACCCTCCCAAGCTATTCTTTGACATCCGTAAAGATGCCGTTAACCGTGGCGAGAGTCCTTCCCTGGGGACTCAGGCTTCGTTCCCAGATGTGAGACCACCTGTGCTAGGCCCCCGGGTTACCTCTGATCCCGAAAACCGGAAGAGCAAAGAATCTTACCTTTTGCAGCCGAGTTATCCAGCCAAGGATGCCACTTCCTCCAGTGCAGCCCAGCCGGAGGTAATAGTTGTCCCTCTCTACCTGGTTAATACTGACAGAGGGCAAGAAGGCACTGCCAGACCTCCAACACCTCTGGGGCCTCTTGGCTGCGTCCCCACAATCCCAGCGACTGCCTCTGCCGCCTCACCTCTGACCTTCCCGACTCTAGATGATTTCATTCCCCCTCATCTGCAGAGGTGGCCCCACCACAGCCAGCCAGCCCGCGCCTCTGGCTCCTTTGCCCCCATTAGCCAGACGCCACCATCCTTCTCACCACCACCTCCGCTGGTCCCTCCTGCCCCGGAGGACCTCCGCAGAGTCTCGGAGCCTGACCTCACGGGAGCTGTTTCGAGTACCGATTCCAGTCCTCTACTAAATGAAGTTTCTTCTTCCCTTATTGGAACTGATTCCCAAGCCTTTCCATCAGTTAGCAAGCCTTCATCCGCCTATCCCTCCACAACGATTGTCAATCCTACTATTGTGCTCTTGCAACACAATCGAGAACAGCAAAAACGACTCAGTAGCCTTTCAGATCCTGTCTCAGAAAGAAGAGTGGGAGAGCAGGACTCAGCACCAACCCAGGAAAAACCCACCTCACCTGGCAAGGCTATTGAAAAAAGAGCAAAGGATGACAGTAGGCGGGTGGTGAAGAGCACTCAGGACTTAAGCGATGTTTCCATGGATGAAGTGGGCATCCCACTCCGGAACACTGAGAGATCAAAAGACTGGTACAAGACTATGTTTAAACAGATCCACAAACTGAACAGAGATGATGATTCAGATCTGTACTCTCCCAGATACTCATTTTCTGAAGACACAAAATCTCCCCTTTCTGTGCCTCGCTCAAAAAGTGAGATGAGCTACATTGATGGTGAGAAGGTAGTCAAGAGGTCGGCCACACTACCCCTCCCAGCCCGCTCTTCCTCACTGAAGTCAAGCTCAGAAAGAAATGACTGGGAACCCCCAGATAAGAAAGTAGACACAAGAAAATATCGTGCAGAGCCCAAGAGCATTTACGAATATCAGCCTGGCAAGTCTTCCGTTCTGACCAACGAAAAGATGAGTCGGGATATAAGCCCAGAAGAGATAGATTTAAAGAATGAACCTTGGTATAAATTCTTTTCGGAATTGGAGTTTGGGAAACCGCCTCCCAAAAAGATATGGGATTATACTCCTGGAGACTGCTCTATCCTTCCTAGAGAGGATAGAAAGAGCTCAGCCATCAGCCCTACTCCGGAAATTTCTTCAGAGACTCCTGGATATATATATTCTTCCAACTTCCATGCAGTGAAGAGGGAATCAGACGGGGCTCCTGGGGATCTCACTAGCTTGGAGAATGAGAGACAAATTTATAAAAGTGTCTTGGAAGGTGGTGACATCCCTCTTCAGGGCCTGAGTGGGCTCAAGCGACCATCCAGCTCTGCTTCCACTAAAGATTCAGAATCGCCAAGACATTTTATACCAGCTGATTACTTGGAATCCACGGAAGAATTTATTCGAAGACGTCATGATGATAAAGAGAAACTTTTAGCGGACCAGAGACGACTTAAACGCGAGCAAGAAGAGGCTGATATTGCAGCTCGACGCCACACAGGCGTCATTCCGACGCACCATCAGTTTATCACTAATGAGCGCTTTGGGGACCTCCTCAATATAGACGATACTGCAAAAAGGAAATCTGGGTCAGAGATGAGACCTGCCAGAGCCAAATTTGACTTTAAAGCTCAGACACTAAAGGAGCTTCCTCTGCAGAAGGGAGATATTGTTTACATTTATAAGCAAATTGATCAGAACTGGTATGAAGGAGAACACCACGGCCGGGTGGGAATCTTCCCACGCACCTACATCGAGCTTCTTCCTCCTGCTGAGAAGGCACAGCCCAAAAAGTTGACACCAGTGCAGGTTTTGGAATATGGAGAAGCTATTGCTAAGTTTAACTTTAATGGTGATACACAAGTAGAAATGTCCTTCAGAAAGGGTGAGAGGATCACACTGCTCCGGCAGGTAGATGAGAACTGGTACGAAGGGAGGATCCCGGGGACATCCCGACAAGGCATCTTCCCCATCACCTACGTGGATGTGATCAAGCGACCACTGGTGAAAAACCCTGTGGATTACATGGACCTGCCTTTCTCCTCCTCCCCAAGTCGCAGTGCCACTGCAAGCCCACAGCAACCTCAAGCCCAGCAGCGAAGAGTCACCCCCGACAGGAGTCAAACCTCACAAGATTTATTTAGCTATCAAGCATTATATAGCTATATACCACAGAATGATGATGAGTTGGAACTCCGCGATGGAGATATCGTTGATGTCATGGAAAAATGTGACGATGGATGGTTTGTTGGTACTTCAAGAAGGACAAAGCAGTTTGGTACTTTTCCAGGCAACTATGTAAAACCTTTGTATCTATAAGAAGACTGAAAACCATGGAGATTATTTTTATTGGAGGAGGAAGCATCATTCATGAACCGATCTTTTTAGTTGAGTCAGTAGGAAAATTAATACAGTGGATAAAGTAAGAAGCAAAAGACAGGGACAGAGAAGTGTTGTGTTTAAAACCCAAGCCTGTCTAAGGTTACTGTGTATTAGACAGGGCCGAACTAGTGTGCTGAGCAAAAAGAATTGAAGCAAATTGTATTTACTTAGCCGCTTCTGGGAGCCACTTCAGCCTTTCCCCTCCCCTCCACTTCTTGGGTAATCTGACCTGAAGCATAGTCCAGGAGCAGAGTTAGCCAGAAATGCCTCCTGCTGCCCCAGCCTTAGAGAGCTCCCATCTCAATCATTGAGCCTGAAGGCTTCAAGCCCAAGAATGCAACAAGACCCCCAGCCTACATTTCTCAGCTCCCCTGGAGCCAGCTGATCCTGTAACGCTGCTGGAGGTCAGTCTGAGCTACCAAGACTGTCCCTAGACAAAGGTGGAGTCCCCCACACTGCCCAAGACCAAATCCCTCACTCAACCTGCTGAGGTGTGGATGGGGAAACAGAGGCAAAACTGAGGCACCTGATGCATTCAGCCTGCTGTGCAGCAGTGCCATTGACTGCCCTGATGTTCAGAGAGAAACGCACACAAGGTTTGCCCATGAGAATTGGGGAGCAGATGGCCAAGCAGATAGGTTATGTCTGTTTTCTGAGTGATGAAGTCAGGAAGCCCTGTGGCTCTGGAGGCCACTTGTGGTTCATTCTTTTCCCATATCCTTGGCTTTTAGAAATGGTTACCTTCAGGACAGTGCAGCTGCATTTATCAGAGCACTATTGCTAAGTTTTCTTTTCTGGCTTGTGTTTTTCTGGGACAGTTTAGAATTGGGAGGCCTATTCTCATAGAACACCAAAAATGATGTTCAGTGATTCATTTAACATACACCAATGTACTCTGGCTGCTGGGGGGACAACCATAAGCAAGACATGCCCAGGGTTTGCCGTGGCTCCAGATCTACTCCCTGTAGGAGTTCAAGGATCACACAAACGGTAGTAACCAGGGTTGTGAATCTGAGTACACCCTGGCAAGGCTTCTCTTCAGACTGAAGCAGCAATTCTGCCACTACCAGCAGCAACCAGGACGTCTGTTCTTTGTGGGGGCCAGATCAGAAGAGAGAGGCCCCTGTGACGCCCGGGCTGCTTGGTCACAACTCTGTCCAATTCAAGGATGTTTATCGGCCTCTCTTAGATCCTGAGTGAGACAAATACAGAAATGACCCATTCCCTGCCCACCAGAAACTCAGAGGTGATTGGGGAGACTGACACAGGAAAATGAACTTAATCAAGAGAGACTGTGATATGTGCTAAGAAGGGTGTGAGGGAGGGAGAGATGAATTTTCCCTGGAGGGATCCTAGAAAGCATTGTCATATTGCCATCTCCATTAGCTCACTTTTAAACAACTAGGGTGCTGGAAGAACCTTTGTCTGAGGGTAGTTCATAGCTGGAAATACTTGGAATATTTTCCAGAGTCTCTAAACTCTCATCTTCCCCCACAGATACACATCCAAGCTCACAAATAGGAGTAGCAATTCTAGGTGGTAGGGTTGTGTACGGAACCCCTGGCTGTCTGCATATATCTCAGAATTACCCCAGGACCATTGTCCCAAAGTCTAGAGTCTTTACAGGTAGGCAAAATTTGTTTTCAATGCCTGTGCCTCAGCTGCTGTCACAAATACCCATCTTAGGATCCCATCAGCTTCCCATCCCCCACCAGACAGCCACAGTACCCTCACTTTCTCCCTATTGTTCTTTCAAATCCTGTTCTCAGGAAAGAAACTGCCACTAATTCATTCACACTAAGGTGTAAATGATTGATAATAGGAATGAGTTACCTCTTCCCACAGACATTTGTTTTTAAGTATGACAGAGCAGGGCCTTAATCCCAAGGGAAAAGGTTATGGAACTGGAGGGGGTGAGCTTTCTGGGTAGAAGGAGACTTCCTGAATTTCCTTAAAACCCAGTAAGAGTAAGACCTGTTGTTTTGGAAGGTCTGCTCCACCATCTAAGAGCACTGTT