Transcript asmbl_17951

Sequence
Transcript Sequence for observation asmbl_17951 of TGE0058610:
ATGAGTGGAGGCTTTCTTCCAGTGCTGATGCCAATGGAAATGCCCAGCCCTCTTCACTCGCTGCCAAGGGCTACAGAAGTGTGCATCCCAACCTTCCTTCTGACAAGTCCCAGGTTCTCTCTCCCCCACGCCCTCCTCTCCCTCAAAAGGACCGCTTTGCATGGCAGTCCCCCACCATCCACAATACCTATAAGGATTCCCTCTACCTGAGCTCACCAAAGCCTTATGTCCCACTCGGCACCCCCAGACAGCAGAACCCCTCACAACCCCAGCCTATCTCTGTCCTCCTGGCAGCTGGATCGGCTCCCAAAGGTGTGGTGTGCCCTGGTTCCTTGCTTCCGGACTCCACGTTCCCCAGTGCTTCATCCCAACCCCAGCAGCGCTATGCAGCCACCAGGACAGTTTATCATAAGAATGTGAGCTCTAACCCATGTCATGAGGCAGTTGGGATTAAAAAGGTCAGCAGCTTATATGTACCTTGTTTATCCAATAACATTTGCCTGGCGGCGTCAGAAAACTCCTCTCGTGTTGCACGTGACCCTGCCGAAGGCACTCCCTTGGAGGCTGCGGGCACCCGAGCACCGGCTCCCGGCCTTGTCTCCCGCACAGCCGGCACAGGAAAACCACCCCCTGCTCCTCCTCCTGACCCTCCCAAGCTATTCTTTGACATCCGTAAAGATGCCGTTAACCGTGGCGAGAGTCCTTCCCTGGGGACTCAGGCTTCGTTCCCAGATGTGAGACCACCTGTGCTAGGCCCCCGGGTTACCTCTGATCCCGAAAACCGGAAGAGCAAAGAATCTTACCTTTTGCAGCCGAGTTATCCAGCCAAGGATTCCAGTCCTCTACTAAATGAAGTTTCTTCTTCCCTTATTGGAACTGATTCCCAAGCCTTTCCATCAGTTAGCAAGCCTTCATCCGCCTATCCCTCCACAACGATTGTCAATCCTACTATTGTGCTCTTGCAACACAATCGAGAACAGCAAAAACGACTCAGTAGCCTTTCAGATCCTGTCTCAGAAAGAAGAGTGGGAGAGCAGGACTCAGCACCAACCCAGGAAAAACCCACCTCACCTGGCAAGGCTATTGAAAAAAGAGCAAAGGATGACAGTAGGCGGGTGGTGAAGAGCACTCAGGACTTAAGCGATGTTTCCATGGATGAAGTGGGCATCCCACTCCGGAACACTGAGAGATCAAAAGACTGGTACAAGACTATGTTTAAACAGATCCACAAACTGAACAGAGATGATGATTCAGATCTGTACTCTCCCAGATACTCATTTTCTGAAGACACAAAATCTCCCCTTTCTGTGCCTCGCTCAAAAAGTGAGATGAGCTACATTGATGGTGAGAAGGTAGTCAAGAGGTCGGCCACACTACCCCTCCCAGCCCGCTCTTCCTCACTGAAGTCAAGCTCAGAAAGAAATGACTGGGAACCCCCAGATAAGAAAGTAGACACAAGAAAATATCGTGCAGAGCCCAAGAGCATTTACGAATATCAGCCTGGCAAGTCTTCCGTTCTGACCAACGAAAAGATGAGTCGGGATATAAGCCCAGAAGAGATAGATTTAAAGAATGAACCTTGGTATAAATTCTTTTCGGAATTGGAGTTTGGGAAACCGAGCTCAGCCATCAGCCCTACTCCGGAAATTTCTTCAGAGACTCCTGGATATATATATTCTTCCAACTTCCATGCAGTGAAGAGGGAATCAGACGGGGCTCCTGGGGATCTCACTAGCTTGGAGAATGAGAGACAAATTTATAAAAGTGTCTTGGAAGGTGGTGACATCCCTCTTCAGGGCCTGAGTGGGCTCAAGCGACCATCCAGCTCTGCTTCCACTAAAGATTCAGAATCGCCAAGACATTTTATACCAGCTGATTACTTGGAATCCACGGAAGAATTTATTCGAAGACGTCATGATGATAAAGAGAAACTTTTAGCGGACCAGAGACGACTTAAACGCGAGCAAGAAGAGGCTGATATTGCAGCTCGACGCCACACAGGCGTCATTCCGACGCACCATCAGTTTATCACTAATGAGCGCTTTGGGGACCTCCTCAATATAGACGATACTGCAAAAAGGAAATCTGGGTCAGAGATGAGACCTGCCAGAGCCAAATTTGACTTTAAAGCTCAGACACTAAAGGAGCTTCCTCTGCAGAAGGGAGATATTGTTTACATTTATAAGCAAATTGATCAGAACTGGTATGAAGGAGAACACCACGGCCGGGTGGGAATCTTCCCACGCACCTACATCGAGCTTCTTCCTCCTGCTGAGAAGGCACAGCCCAAAAAGTTGACACCAGTGCAGGTTTTGGAATATGGAGAAGCTATTGCTAAGTTTAACTTTAATGGTGATACACAAGTAGAAATGTCCTTCAGAAAGGGTGAGAGGATCACACTGCTCCGGCAGGTAGATGAGAACTGGTACGAAGGGAGGATCCCGGGGACATCCCGACAAGGCATCTTCCCCATCACCTACGTGGATGTGATCAAGCGACCACTGGTGAAAAACCCTGTGGATTACATGGACCTGCCTTTCTCCTCCTCCCCAAGTCGCAGTGCCACTGCAAGCCCACAGCAACCTCAAGCCCAGCAGCGAAGAGTCACCCCCGACAGGAGTCAAACCTCACAAGATTTATTTAGCTATCAAGCATTATATAGCTATATACCACAGAATGATGATGAGTTGGAACTCCGCGATGGAGATATCGTTGATGTCATGGAAAAATGTGACGATGGATGGTTTGTTGGTACTTCAAGAAGGACAAAGCAGTTTGGTACTTTTCCAGGCAACTATGTAAAACCTTTGTATCTATAAGAAGACTGAAAACCATGGAGATTATTTTTATTGGAGGAGGAAGCATCATTCATGAACCGATCTTTTTAGTTGAGTCAGTAGGAAAATTAATACAGTGGATAAAGTAAGAAGCAAAAGACAGGGACAGAGAAGTGTTGTGTTTAAAACCCAAGCCTGTCTAAGGTTACTGTGTATTAGACAGGGCCGAACTAGTGTGCTGAGCAAAAAGAATTGAAGCAAATTGTATTTACTTAGCCGCTTCTGGGAGCCACTTCAGCCTTTCCCCTCCCCTCCACTTCTTGGGTAATCTGACCTGAAGCATAGTCCAGGAGCAGAGTTAGCCAGAAATGCCTCCTGCTGCCCCAGCCTTAGAGAGCTCCCATCTCAATCATTGAGCCTGAAGGCTTCAAGCCCAAGAATGCAACAAGACCCCCAGCCTACATTTCTCAGCTCCCCTGGAGCCAGCTGATCCTGTAACGCTGCTGGAGGTCAGTCTGAGCTACCAAGACTGTCCCTAGACAAAGGTGGAGTCCCCCACACTGCCCAAGACCAAATCCCTCACTCAACCTGCTGAGGTGTGGATGGGGAAACAGAGGCAAAACTGAGGCACCTGATGCATTCAGCCTGCTGTGCAGCAGTGCCATTGACTGCCCTGATGTTCAGAGAGAAACGCACACAAGGTTTGCCCATGAGAATTGGGGAGCAGATGGCCAAGCAGATAGGTTATGTCTGTTTTCTGAGTGATGAAGTCAGGAAGCCCTGTGGCTCTGGAGGCCACTTGTGGTTCATTCTTTTCCCATATCCTTGGCTTTTAGAAATGGTTACCTTCAGGACAGTGCAGCTGCATTTATCAGAGCACTATTGCTAAGTTTTCTTTTCTGGCTTGTGTTTTTCTGGGACAGTTTAGAATTGGGAGGCCTATTCTCATAGAACACCAAAAATGATGTTCAGTGATTCATTTAACATACACCAATGTACTCTGGCTGCTGGGGGGACAACCATAAGCAAGACATGCCCAGGGTTTGCCGTGGCTCCAGATCTACTCCCTGTAGGAGTTCAAGGATCACACAAACGGTAGTAACCAGGGTTGTGAATCTGAGTACACCCTGGCAAGGCTTCTCTTCAGACTGAAGCAGCAATTCTGCCACTACCAGCAGCAACCAGGACGTCTGTTCTTTGTGGGGGCCAGATCAGAAGAGAGAGGCCCCTGTGACGCCCGGGCTGCTTGGTCACAACTCTGTCCAATTCAAGGATGTTTATCGGCCTCTCTTAGATCCTGAGTGAGACAAATACAGAAATGACCCATTCCCTGCCCACCAGAAACTCAGAGGTGATTGGGGAGACTGACACAGGAAAATGAACTTAATCAAGAGAGACTGTGATATGTGCTAAGAAGGGTGTGAGGGAGGGAGAGATGAATTTTCCCTGGAGGGATCCTAGAAAGCATTGTCATATTGCCATCTCCATTAGCTCACTTTTAAACAACTAGGGTGCTGGAAGAACCTTTGTCTGAGGGTAGTTCATAGCTGGAAATACTTGGAATATTTTCCAGAGTCTCTAAACTCTCATCTTCCCCCACAGATACACATCCAAGCTCACAAATAGGAGTAGCAATTCTAGGTGGTAGGGTTGTGTACGGAACCCCTGGCTGTCTGCATATATCTCAGAATTACCCCAGGACCATTGTCCCAAAGTCTAGAGTCTTTACAGGTAGGCAAAATTTGTTTTCAATGCCTGTGCCTCAGCTGCTGTCACAAATACCCATCTTAGGATCCCATCAGCTTCCCATCCCCCACCAGACAGCCACAGTACCCTCACTTTCTCCCTATTGTTCTTTCAAATCCTGTTCTCAGGAAAGAAACTGCCACTAATTCATTCACACTAAGGTGTAAATGATTGATAATAGGAATGAGTTACCTCTTCCCACAGACATTTGTTTTTAAGTATGACAGAGCAGGGCCTTAATCCCAAGGGAAAAGGTTATGGAACTGGAGGGGGTGAGCTTTCTGGGTAGAAGGAGACTTCCTGAATTTCCTTAAAACCCAGTAAGAGTAAGACCTGTTGTTTTGGAAGGTCTGCTCCACCATCTAAGAGCACTGTT