Transcript asmbl_17949

Sequence
Transcript Sequence for observation asmbl_17949 of TGE0056137:
TAAATCTTGAGGGAAGGAGGTTTGAGAGGGAGTTGGGGGCTTTGGTGCTTCTCCCACTGGTGTTTAGTTCACTTGGCTCCCTTCTTGAGTCAGGATGTCTAATAAAGATGCAGTCAGCCAAGGATTGGTGTCACAATTGATGTAGCATGTGGCCTGCTACGGGCTGGGCTCAGCCTCTCTGGATACAAAGGAGAGTCAGGCCTACCTCTCCAGGATTCCAGTCCTCTACTAAATGAAGTTTCTTCTTCCCTTATTGGAACTGATTCCCAAGCCTTTCCATCAGTTAGCAAGCCTTCATCCGCCTATCCCTCCACAACGATTGTCAATCCTACTATTGTGCTCTTGCAACACAATCGAGAACAGCAAAAACGACTCAGTAGCCTTTCAGATCCTGTCTCAGAAAGAAGAGTGGGAGAGCAGGACTCAGCACCAACCCAGGAAAAACCCACCTCACCTGGCAAGGCTATTGAAAAAAGAGCAAAGGATGACAGTAGGCGGGTGGTGAAGAGCACTCAGGACTTAAGCGATGTTTCCATGGATGAAGTGGGCATCCCACTCCGGAACACTGAGAGATCAAAAGACTGGTACAAGACTATGTTTAAACAGATCCACAAACTGAACAGAGATGATGATTCAGATCTGTACTCTCCCAGATACTCATTTTCTGAAGACACAAAATCTCCCCTTTCTGTGCCTCGCTCAAAAAGTGAGATGAGCTACATTGATGGTGAGAAGGTAGTCAAGAGGTCGGCCACACTACCCCTCCCAGCCCGCTCTTCCTCACTGAAGTCAAGCTCAGAAAGAAATGACTGGGAACCCCCAGATAAGAAAGTAGACACAAGAAAATATCGTGCAGAGCCCAAGAGCATTTACGAATATCAGCCTGGCAAGTCTTCCGTTCTGACCAACGAAAAGATGAGTCGGGATATAAGCCCAGAAGAGATAGATTTAAAGAATGAACCTTGGTATAAATTCTTTTCGGAATTGGAGTTTGGGAAACCGAGCTCAGCCATCAGCCCTACTCCGGAAATTTCTTCAGAGACTCCTGGATATATATATTCTTCCAACTTCCATGCAGTGAAGAGGGAATCAGACGGGGCTCCTGGGGATCTCACTAGCTTGGAGAATGAGAGACAAATTTATAAAAGTGTCTTGGAAGGTGGTGACATCCCTCTTCAGGGCCTGAGTGGGCTCAAGCGACCATCCAGCTCTGCTTCCACTAAAGATTCAGAATCGCCAAGACATTTTATACCAGCTGATTACTTGGAATCCACGGAAGAATTTATTCGAAGACGTCATGATGATAAAGAGAAACTTTTAGCGGACCAGAGACGACTTAAACGCGAGCAAGAAGAGGCTGATATTGCAGCTCGACGCCACACAGGCGTCATTCCGACGCACCATCAGTTTATCACTAATGAGCGCTTTGGGGACCTCCTCAATATAGACGATACTGCAAAAAGGAAATCTGGGTCAGAGATGAGACCTGCCAGAGCCAAATTTGACTTTAAAGCTCAGACACTAAAGGAGCTTCCTCTGCAGAAGGGAGATATTGTTTACATTTATAAGCAAATTGATCAGAACTGGTATGAAGGAGAACACCACGGCCGGGTGGGAATCTTCCCACGCACCTACATCGAGCTTCTTCCTCCTGCTGAGAAGGCACAGCCCAAAAAGTTGACACCAGTGCAGGTTTTGGAATATGGAGAAGCTATTGCTAAGTTTAACTTTAATGGTGATACACAAGTAGAAATGTCCTTCAGAAAGGGTGAGAGGATCACACTGCTCCGGCAGGTAGATGAGAACTGGTACGAAGGGAGGATCCCGGGGACATCCCGACAAGGCATCTTCCCCATCACCTACGTGGATGTGATCAAGCGACCACTGGTGAAAAACCCTGTGGATTACATGGACCTGCCTTTCTCCTCCTCCCCAAGTCGCAGTGCCACTGCAAGCCCACAGCAACCTCAAGCCCAGCAGCGAAGAGTCACCCCCGACAGGAGTCAAACCTCACAAGATTTATTTAGCTATCAAGCATTATATAGCTATATACCACAGAATGATGATGAGTTGGAACTCCGCGATGGAGATATCGTTGATGTCATGGAAAAATGTGACGATGGATGGTTTGTTGGTACTTCAAGAAGGACAAAGCAGTTTGGTACTTTTCCAGGCAACTATGTAAAACCTTTGTATCTATAAGAAGACTGAAAACCATGGAGATTATTTTTATTGGAGGAGGAAGCATCATTCATGAACCGATCTTTTTAGTTGAGTCAGTAGGAAAATTAATACAGTGGATAAAGTAAGAAGCAAAAGACAGGGACAGAGAAGTGTTGTGTTTAAAACCCAAGCCTGTCTAAGGTTACTGTGTATTAGACAGGGCCGAACTAGTGTGCTGAGCAAAAAGAATTGAAGCAAATTGTATTTACTTAGCCGCTTCTGGGAGCCACTTCAGCCTTTCCCCTCCCCTCCACTTCTTGGGTAATCTGACCTGAAGCATAGTCCAGGAGCAGAGTTAGCCAGAAATGCCTCCTGCTGCCCCAGCCTTAGAGAGCTCCCATCTCAATCATTGAGCCTGAAGGCTTCAAGCCCAAGAATGCAACAAGACCCCCAGCCTACATTTCTCAGCTCCCCTGGAGCCAGCTGATCCTGTAACGCTGCTGGAGGTCAGTCTGAGCTACCAAGACTGTCCCTAGACAAAGGTGGAGTCCCCCACACTGCCCAAGACCAAATCCCTCACTCAACCTGCTGAGGTGTGGATGGGGAAACAGAGGCAAAACTGAGGCACCTGATGCATTCAGCCTGCTGTGCAGCAGTGCCATTGACTGCCCTGATGTTCAGAGAGAAACGCACACAAGGTTTGCCCATGAGAATTGGGGAGCAGATGGCCAAGCAGATAGGTTATGTCTGTTTTCTGAGTGATGAAGTCAGGAAGCCCTGTGGCTCTGGAGGCCACTTGTGGTTCATTCTTTTCCCATATCCTTGGCTTTTAGAAATGGTTACCTTCAGGACAGTGCAGCTGCATTTATCAGAGCACTATTGCTAAGTTTTCTTTTCTGGCTTGTGTTTTTCTGGGACAGTTTAGAATTGGGAGGCCTATTCTCATAGAACACCAAAAATGATGTTCAGTGATTCATTTAACATACACCAATGTACTCTGGCTGCTGGGGGGACAACCATAAGCAAGACATGCCCAGGGTTTGCCGTGGCTCCAGATCTACTCCCTGTAGGAGTTCAAGGATCACACAAACGGTAGTAACCAGGGTTGTGAATCTGAGTACACCCTGGCAAGGCTTCTCTTCAGACTGAAGCAGCAATTCTGCCACTACCAGCAGCAACCAGGACGTCTGTTCTTTGTGGGGGCCAGATCAGAAGAGAGAGGCCCCTGTGACGCCCGGGCTGCTTGGTCACAACTCTGTCCAATTCAAGGATGTTTATCGGCCTCTCTTAGATCCTGAGTGAGACAAATACAGAAATGACCCATTCCCTGCCCACCAGAAACTCAGAGGTGATTGGGGAGACTGACACAGGAAAATGAACTTAATCAAGAGAGACTGTGATATGTGCTAAGAAGGGTGTGAGGGAGGGAGAGATGAATTTTCCCTGGAGGGATCCTAGAAAGCATTGTCATATTGCCATCTCCATTAGCTCACTTTTAAACAACTAGGGTGCTGGAAGAACCTTTGTCTGAGGGTAGTTCATAGCTGGAAATACTTGGAATATTTTCCAGAGTCTCTAAACTCTCATCTTCCCCCACAGATACACATCCAAGCTCACAAATAGGAGTAGCAATTCTAGGTGGTAGGGTTGTGTACGGAACCCCTGGCTGTCTGCATATATCTCAGAATTACCCCAGGACCATTGTCCCAAAGTCTAGAGTCTTTACAGGTAGGCAAAATTTGTTTTCAATGCCTGTGCCTCAGCTGCTGTCACAAATACCCATCTTAGGATCCCATCAGCTTCCCATCCCCCACCAGACAGCCACAGTACCCTCACTTTCTCCCTATTGTTCTTTCAAATCCTGTTCTCAGGAAAGAAACTGCCACTAATTCATTCACACTAAGGTGTAAATGATTGATAATAGGAATGAGTTACCTCTTCCCACAGACATTTGTTTTTAAGTATGACAGAGCAGGGCCTTAATCCCAAGGGAAAAGGTTATGGAACTGGAGGGGGTGAGCTTTCTGGGTAGAAGGAGACTTCCTGAATTTCCTTAAAACCCAGTAAGAGTAAGACCTGTTGTTTTGGAAGGTCTGCTCCACCATCTAAGAGCACTGTT