Transcript asmbl_17894

Sequence
Transcript Sequence for observation asmbl_17894 of TGE0058606:
ATTTAACTTGAAGACAACGTCACTAGCAGTTTCTGGAGCTACTTGCCAAGGCTGAGTGTGAGCTGAGCCTGCCCCACCACCAAGATGATCCTGAGCTTGCTGTTCAGCCTTGGGGGCCCCCTGGGCTGGGGGCTGCTGGGGGCATGGGCCCAGGCTTCCAGTACTAGCCTCTCTGATCTGCAGAGCTCCAGGACACCTGGGGTCTGGAAGGCAGAGGCTGAGGACACCGGCAAGGACCCCGTAGGACGTAACTGGTGCCCCTACCCAATGTCCAAGCTGGTCACCTTACTAGCTCTTTGCAAAACAGAGAAATTCCTCATCCACTCGCAGCAGCCGTGTCCGCAGGGAGCTCCAGACTGCCAGAAAGTCAAAGTCATGTACCGCATGGCCCACAAGCCAGTGTACCAGGTCAAGCAGAAGGTGCTGACCTCTTTGGCCTGGAGGTGCTGCCCTGGCTACACGGGCCCCAACTGCGAGCACCACGATTCCATGGCAATCCCTGAGCCTGCAGATCCTGGTGACAGCCACCAGGAACCTCAGGATGGACCAGTCAGCTTCAAACCTGGCCACCTTGCTGCAGTGATCAATGAGGTTGAGGTGCAACAGGAACAGCAGGAACATCTGCTGGGAGATCTCCAGAATGATGTGCACCGGGTGGCAGACAGCCTGCCAGGCCTGTGGAAAGCCCTGCCTGGTAACCTCACAGCTGCAGTGATGGAAGCAAATCAAACAGGGCACGAGTTCCCTGATAGATCCTTGGAGCAGGTGCTGCTACCCCACGTGGACACCTTCCTACAAGTGCATTTCAGCCCCATCTGGAGGAGCTTTAACCAAAGCCTGCACAGCCTTACCCAGGCCATAAGAAACCTGTCTCTTGACGTGGAGGCCAACCGCCAGGCCATCTCCAGAGTCCAGGACAGTGCCGTGGCCAGGGCTGACTTCCAGGAGCTTGGTGCCAAATTTGAGGCCAAGGTCCAGGAGAACACTCAGAGAGTGGGTCAGCTGCGACAGGACGTGGAGGACCGCCTGCACGCCCAGCACTTTACCCTGCACCGCTCGATCTCAGAGCTCCAAGCCGATGTGGACACCAAATTGAAGAGGCTGCACAAGGCTCAGGAGGCCCCAGGGACCAATGGCAGTCTGGTGTTGGCAACGCCTGGGGCTGGGGCAAGGCCTGAGCCGGACAGCCTGCAGGCCAGGCTGGGCCAGCTGCAGAGGAACCTCTCAGAGCTGCACATGACCACGGCCCGCAGGGAGGAGGAGTTGCAGTACACCCTGGAGGACATGAGGGCCACCCTGACCCGGCACGTGGATGAGATCAAGGAACTGTACTCCGAATCGGACGAGACTTTCGATCAGATTAGCAAGGTGGAGCGGCAGGTGGAGGAGCTGCAGGTGAACCACACGGCGCTCCGTGAGCTGCGCGTGATCCTGATGGAGAAGTCTCTGATCATGGAGGAGAACAAGGAGGAGGTGGAGCGGCAGCTCCTGGAGCTCAACCTCACGCTGCAGCACCTGCAGGGTGGCCATGCCGACCTCATCAAGTACGTGAAGGACTGCAATTGCCAGAAGCTCTATTTAGACCTGGACGTCATCCGGGAGGGCCAGAGGGACGCCACGCGTGCCCTGGAGGAGACCCAGGTGAGCCTGGACGAGCGGCGGCAGCTGGACGGCTCCTCCCTGCAGGCCCTGCAGAACGCCGTGGACGCCGTGTCGCTGGCCGTGGACGCGCACAAAGCGGAGGGCGAGCGGGCGCGGGCGGCCACGTCGCGGCTCCGGAGCCAAGTGCAGGCGCTGGATGACGAGGTGGGCGCGCTGAAGGCGGCCGCGGCCGAGGCCCGCCACGAGGTGCGCCAGCTGCACAGCGCCTTCGCCGCCCTGCTGGAGGACGCGCTGCGGCACGAGGCGGTGCTGGCCGCGCTCTTCGGGGAGGAGGTGCTGGAGGAGATGTCTGAGCAGACGCCGGGACCGCTGCCCCTGAGCTACGAGCAGATCCGCGTGGCCCTGCAGGACGCCGCTAGCGGGCTGCAGGAGCAGGCGCTCGGCTGGGACGAGCTGGCCGCCCGAGTGACGGCCCTGGAGCAGGCCTCGGAGCCCCCGCGGCCGGCAGAGCACCTGGAGCCCAGCCACGACGCGGGCCGCGAGGAGGCCGCCACCACCGCCCTGGCCGGGCTGGCGCGGGAGCTCCAGAGCCTGAGCAACGACGTCAAGAATGTCGGGCGGTGCTGCGAGGCCGAGGCCGGGGCCGGGGCCGCCTCCCTCAACGCCTCCCTTCACGGCCTCCACAACGCACTCTTCGCCACTCAGCGCAGCTTGGAGCAGCACCAGCGGCTCTTCCACAGCCTCTTTGGGAACTTCCAAGGGCTCATGGAAGCCAACGTCAGCCTGGACCTGGGGAAGCTGCAGACCATGCTGAGCAGGAAAGGGAAGAAGCAGCAGAAAGACCTGGAAGCTCCCCGGAAGAGGGACAAGAAGGAAGCGGAGCCTTTGGTGGACATACGGGTCACAGGGCCTGTGCCAGGTGCCTTGGGCGCGGCGCTCTGGGAGGCAGGATCCCCTGTGGCCTTCTATGCCAGCTTTTCAGAAGGGACGGCTGCCCTGCAGACAGTGAAGTTCAACACCACATACATCAACATTGGCAGCAGCTACTTCCCTGAACATGGCTACTTCCGAGCCCCTGAGCGTGGTGTCTACCTGTTTGCAGTGAGCGTTGAATTTGGCCCAGGGCCAGGCACCGGGCAGCTGGTGTTTGGAGGTCACCATCGGACTCCAGTCTGTACCACTGGGCAGGGGAGTGGAAGCACAGCAACGGTCTTTGCCATGGCTGAGCTGCAGAAGGGTGAGCGAGTATGGTTTGAGTTAACCCAGGGATCAATAACAAAGAGAAGCCTGTCGGGCACTGCATTTGGGGGCTTCCTGATGTTTAAGACCTGAACCCCAGCCCCAATCTGATCAGACATCATGGACTCGCCCAGCTCTCCTCGGCCTGGGGCTCTGGCCAAGGATGGGCTGGAGGTCATTCAGTTGGTCTGTCTCTTCCCTGGAAACCTTCTGCAAAGATGGTGTGGTGTACGTGGCTTCCCTGTAACCACATGGGGCTTGGCCATTTCTCCATGATGAGAAGGACTGGAATGCTTCTCCGGGCAGGACATGGTCCTAGGAAGCCTGAACCTTGGCTTGGCATGCCTTCTCAGACAGCACGGCCTGGGCTCCAACTCTTCACCACACCCTGTATTCTACAACTTCTTTGGTGTTTTGCTCCTCCTGTGGTTGGAAACTTCTGTACAACACTTTAAACTTTTCTCTTGCTTCCTCTTCTCTTCTCCCTTATCGTATGATAGAAAGACATTCTTCCCCAGGAGGAATGTTTAAAATGGAGGCAACATTTTGGCCAACATTGGAAAGCACTAGAGGGCAATGGGATTAAACCAACCTGCTTGGTCTCTATTAGTCAGTAATGAAGACGACAGCCTGGCCAACCAAGGGAAAGGAAATTAGTATCTTTAGTTTCAGTCATTCCTTGTAGGATATGGTTTAGCTGTGCCCCCACCTAAAATATCATCTTGAATTGTAATCCCTATAATCCCCACATCAAGGGAGAGATCAGGTGGAGGTAATTGGATCTTGGGGGCGGTTCCCCCATGCTGTTCTTGTGATAGTTCTCACGAGATCTGATGATTTTATAAGTTTGATAGTTCCTCCTGTGTTCATTCTCCTTCCTGCCACCTTGTGAAGATGCCTTGGTTCCTCTTCACTGTCTGCCATGATTGTAAG