Transcript asmbl_17893

Sequence
Transcript Sequence for observation asmbl_17893 of TGE0058605:
GGGGCTGAGGAAGAGCCTGGTCACATTGAGGGGAGGAGGGGAGGACCCCGCTGGTCCCAGCCTGGGAGGAGTGTCTGCTCCTGCAGGGCTTGTGTCACACCACATGTCTGTTGCAGAGTTCCCTGATAGATCCTTGGAGCAGGTGCTGCTACCCCACGTGGACACCTTCCTACAAGTGCATTTCAGCCCCATCTGGAGGAGCTTTAACCAAAGCCTGCACAGCCTTACCCAGGCCATAAGAAACCTGTCTCTTGACGTGGAGGCCAACCGCCAGGCCATCTCCAGAGTCCAGGACAGTGCCGTGGCCAGGGCTGACTTCCAGGAGCTTGGTGCCAAATTTGAGGCCAAGGTCCAGGAGAACACTCAGAGAGTGGGTCAGCTGCGACAGGACGTGGAGGACCGCCTGCACGCCCAGCACTTTACCCTGCACCGCTCGATCTCAGAGCTCCAAGCCGATGTGGACACCAAATTGAAGAGGCTGCACAAGGCTCAGGAGGCCCCAGGGACCAATGGCAGTCTGGTGTTGGCAACGCCTGGGGCTGGGGCAAGGCCTGAGCCGGACAGCCTGCAGGCCAGGCTGGGCCAGCTGCAGAGGAACCTCTCAGAGCTGCACATGACCACGGCCCGCAGGGAGGAGGAGTTGCAGTACACCCTGGAGGACATGAGGGCCACCCTGACCCGGCACGTGGATGAGATCAAGGAACTGTACTCCGAATCGGACGAGACTTTCGATCAGATTAGCAAGGTGGAGCGGCAGGTGGAGGAGCTGCAGGTGAACCACACGGCGCTCCGTGAGCTGCGCGTGATCCTGATGGAGAAGTCTCTGATCATGGAGGAGAACAAGGAGGAGGTGGAGCGGCAGCTCCTGGAGCTCAACCTCACGCTGCAGCACCTGCAGGGTGGCCATGCCGACCTCATCAAGTACGTGAAGGACTGCAATTGCCAGAAGCTCTATTTAGACCTGGACGTCATCCGGGAGGGCCAGAGGGACGCCACGCGTGCCCTGGAGGAGACCCAGGTGAGCCTGGACGAGCGGCGGCAGCTGGACGGCTCCTCCCTGCAGGCCCTGCAGAACGCCGTGGACGCCGTGTCGCTGGCCGTGGACGCGCACAAAGCGGAGGGCGAGCGGGCGCGGGCGGCCACGTCGCGGCTCCGGAGCCAAGTGCAGGCGCTGGATGACGAGGTGGGCGCGCTGAAGGCGGCCGCGGCCGAGGCCCGCCACGAGGTGCGCCAGCTGCACAGCGCCTTCGCCGCCCTGCTGGAGGACGCGCTGCGGCACGAGGCGGTGCTGGCCGCGCTCTTCGGGGAGGAGGTGCTGGAGGAGATGTCTGAGCAGACGCCGGGACCGCTGCCCCTGAGCTACGAGCAGATCCGCGTGGCCCTGCAGGACGCCGCTAGCGGGCTGCAGGAGCAGGCGCTCGGCTGGGACGAGCTGGCCGCCCGAGTGACGGCCCTGGAGCAGGCCTCGGAGCCCCCGCGGCCGGCAGAGCACCTGGAGCCCAGCCACGACGCGGGCCGCGAGGAGGCCGCCACCACCGCCCTGGCCGGGCTGGCGCGGGAGCTCCAGAGCCTGAGCAACGACGTCAAGAATGTCGGGCGGTGCTGCGAGGCCGAGGCCGGGGCCGGGGCCGCCTCCCTCAACGCCTCCCTTCACGGCCTCCACAACGCACTCTTCGCCACTCAGCGCAGCTTGGAGCAGCACCAGCGGCTCTTCCACAGCCTCTTTGGGAACTTCCAAGGGCTCATGGAAGCCAACGTCAGCCTGGACCTGGGGAAGCTGCAGACCATGCTGAGCAGGAAAGGGAAGAAGCAGCAGAAAGACCTGGAAGCTCCCCGGAAGAGGGACAAGAAGGAAGCGGAGCCTTTGGTGGACATACGGGTCACAGGGCCTGTGCCAGGTGCCTTGGGCGCGGCGCTCTGGGAGGCAGGATCCCCTGTGGCCTTCTATGCCAGCTTTTCAGAAGGGACGGCTGCCCTGCAGACAGTGAAGTTCAACACCACATACATCAACATTGGCAGCAGCTACTTCCCTGAACATGGCTACTTCCGAGCCCCTGAGCGTGGTGTCTACCTGTTTGCAGTGAGCGTTGAATTTGGCCCAGGGCCAGGCACCGGGCAGCTGGTGTTTGGAGGTCACCATCGGACTCCAGTCTGTACCACTGGGCAGGGGAGTGGAAGCACAGCAACGGTCTTTGCCATGGCTGAGCTGCAGAAGGGTGAGCGAGTATGGTTTGAGTTAACCCAGGGATCAATAACAAAGAGAAGCCTGTCGGGCACTGCATTTGGGGGCTTCCTGATGTTTAAGACCTGAACCCCAGCCCCAATCTGATCAGACATCATGGACTCGCCCAGCTCTCCTCGGCCTGGGGCTCTGGCCAAGGATGGGCTGGAGGTCATTCAGTTGGTCTGTCTCTTCCCTGGAAACCTTCTGCAAAGATGGTGTGGTGTACGTGGCTTCCCTGTAACCACATGGGGCTTGGCCATTTCTCCATGATGAGAAGGACTGGAATGCTTCTCCGGGCAGGACATGGTCCTAGGAAGCCTGAACCTTGGCTTGGCATGCCTTCTCAGACAGCACGGCCTGGGCTCCAACTCTTCACCACACCCTGTATTCTACAACTTCTTTGGTGTTTTGCTCCTCCTGTGGTTGGAAACTTCTGTACAACACTTTAAACTTTTCTCTTGCTTCCTCTTCTCTTCTCCCTTATCGTATGATAGAAAGACATTCTTCCCCAGGAGGAATGTTTAAAATGGAGGCAACATTTTGGCCAACATTGGAAAGCACTAGAGGGCAATGGGATTAAACCAACCTGCTTGGTCTCTATTAGTCAGTAATGAAGACGACAGCCTGGCCAACCAAGGGAAAGGAAATTAGTATCTTTAGTTTCAGTCATTCCTTGTAGGATATGGTTTAGCTGTGCCCCCACCTAAAATATCATCTTGAATTGTAATCCCTATAATCCCCACATCAAGGGAGAGATCAGGTGGAGGTAATTGGATCTTGGGGGCGGTTCCCCCATGCTGTTCTTGTGATAGTTCTCACGAGATCTGATGATTTTATAAGTTTGATAGTTCCTCCTGTGTTCATTCTCCTTCCTGCCACCTTGTGAAGATGCCTTGGTTCCTCTTCACTGTCTGCCATGATTGTAAG