Transcript asmbl_178494

Sequence
Transcript Sequence for observation asmbl_178494 of TGE0056129:
GTCTACAAGAAAATTGCTCCCTTTGAAGCTGCCAGGGGGGCCGGGAAGCCTGCCCCCTCCTGCTCGCCCGCCCTCTCCGCCCCACCAGCCCCCTCCCTCCTTTCCTCCCTCCCCGCCCTCTCCCCGCTGTCCCCTCCCCGTCGGCCCGCCTGCCCAGCCTTTAGCCTCCCGCCCGCCGCCTCTGTCTCCCTCTCTCCACAAACTGCCCAGGAGTGAGTAGCTGCTTTCGGTCCGCCGGACACACCGGACAGATAGACGTGCGGACGGCCCACCACCCCAGCCCGCCAACTAGTCAGCCTGCGCCTGGCGCCTCCCCTCTCCAGGTCCATCCGCCATGTGGCCCCTGTGGCGCCTCGTGTCTCTGCTGGCCCTGAGCCAGGCCCTGCCCTTTGAGCAGAGAGGCTTCTGGGACTTCACCCTGGACGATGGGCCATTCATGATGAACGATGAGGAAGCTTCGGGCGCTGACACCTCGGGCGTCCTGGACCCGGACTCTGTCACACCCACCTACAGCGCCATGTGTCCTTTCGGCTGCCACTGCCACCTGCGGGTGGTTCAGTGCTCCGACCTGGGTCTGAAGTCTGTGCCCAAAGAGATCTCCCCTGACACCACGCTGCTGGACCTGCAGAACAACGACATCTCCGAGCTCCGCAAGGATGACTTCAAGGGTCTCCAGCACCTCTACGCCCTCGTCCTGGTGAACAACAAGATCTCCAAGATCCATGAGAAGGCCTTCAGCCCACTGCGGAAGCTGCAGAAGCTCTACATCTCCAAGAACCACCTGGTGGAGATCCCGCCCAACCTACCCAGCTCCCTGGTGGAGCTCCGCATCCACGACAACCGCATCCGCAAGGTGCCCAAGGGAGTGTTCAGCGGGCTCCGGAACATGAACTGCATCGAGATGGGCGGGAACCCACTGGAGAACAGTGGCTTTGAACCTGGAGCCTTCGATGGCCTGAAGCTCAACTACCTGCGCATCTCAGAGGCCAAGCTGACTGGCATCCCCAAAGACCTCCCTGAGACCCTGAATGAACTCCACCTAGACCACAACAAAATCCAGGCCATCGAACTGGAGGACCTGCTTCGCTACTCCAAGCTGTACAGGCTGGGCCTAGGCCACAACCAGATCAGGATGATCGAGAACGGGAGCCTGAGCTTCCTGCCCACCCTCCGGGAGCTCCACTTGGACAACAACAAGTTGGCCAGGGTGCCCTCAGGGCTCCCAGACCTCAAGCTCCTCCAGGTGGTCTATCTGCACTCCAACAACATCACCAAAGTGGGTGTCAACGACTTCTGTCCCATGGGCTTCGGGGTGAAGCGGGCCTACTACAACGGCATCAGCCTCTTCAACAACCCCGTGCCCTACTGGGAGGTGCAGCCGGCCACTTTCCGCTGCGTCACTGACCGCCTGGCCATCCAGTTTGGCAACTACAAAAAGTAGAGGCAGCTGCAGCCACCGCGGGGCCTCAGTGGGGGTCTCTGGGGAACACAGCCAGACATCCTGATGGGGAGGCAGAGCCAGGAAGCTAAGCCAGGGCCCAGCTGCGTCCAACCCAGCCCCCCACCTCGGGTCCCTGACCCCAGCTCGATGCCCCATCACCGCCTCTCCCTGGCTCCCAAGGGTGCAGGTGGGCGCAAGGCCCGGCCCCCATCACATGTTCCCTTGGCCTCAGAGCTGCCCCTGCTCTCCCACCACAGCCACCCAGAGGCACCCCATGAAGCTTTTTTCTCGTTCACTCCCAAACCCAAGTGTCCAAGGCTCCAGTCCTAGGAGAACAGTCCCTGGGTCAGCAGCCAGGAGGCGGTCCATAAGAATGGGGACAGTGGGCTCTGCCAGGGCTGCCGCACCTGTCCAGACACACATGTTCTGTTCCTCCTCCTCATGCATTTCCAGCCTTTCAACCCTCCCCGACTCTGCGGCTCCCCTCAGCCCCCTTGCAAGTTCATGGCCTGTCCCTCCCAGACCCCTGCTCCACTGGCCCTTCGACCAGTCCTCCCTTCTGTTCTCTCTTTCCCCGTCCTTCCTCTCTCTCTCTCTCTCTCTCTC