Transcript asmbl_178434

Sequence
Transcript Sequence for observation asmbl_178434 of TGE0003205:
CTGTGTGTCAGCAGGAGGCAGAAGGCCCTGTGGCTCATCCAGTGGCCTGATTTCCTTTGTTTGGAGGCTTGGTTCTGAGTGAGAGTTCAACAGCCTTTGCCCAGGCGGCTTCTCAAACACAGGGTGTGGTTTCCTTAGCTCACTCTCTGCTGTTTGGTTGCTCATGGCAACAAGATCCAAATAACTTGGACATGTGTTTGTATAAAAAAAACCTGGGAATGGAACCCAAAGTGAGACTTTGGGGCTTTCAGTTAGTGGAAGAGCTGCGGTCCCTCCAGCTACAAGGTGGGCACCATGGCGGAGAAGTTTGACTGCCACTACTGCAGGGATCCCTTGCAGGGGAAGAAGTATGTGCAAAAGGATGGCCACCACTGCTGCCTGAAATGCTTTGACAAGTTCTGTGCCAACACCTGTGTGGAATGCCGCAAGCCCATCGGTGCGGACTCCAAGGAGGTGCACTATAAGAACCGCTTCTGGCATGACACCTGCTTCCGCTGTGCCAAGTGCCTTCACCCCTTGGCCAATGAGACCTTTGTGGCCAAGGACAACAAGATCCTGTGCAACAAGTGCACCACTCGGGAGGACTCCCCCAAGTGCAAGGGGTGCTTCAAGGCCATTGTGGCAGGAGATCAAAACGTGGAGTACAAGGGGACCGTCTGGCACAAAGACTGCTTCACCTGTAGTAACTGCAAGCAAGTCATCGGGACTGGAAGCTTCTTCCCTAAAGGGGAGGACTTCTACTGCGTGACTTGCCATGAGACCAAGTTTGCCAAGCATTGCGTGAAGTGCAACAAGGCCATCACATCTGGAGGAATCACTTACCAGGATCAGCCCTGGCATGCCGATTGCTTTGTGTGTGTTACCTGCTCTAAGAAGCTGGCTGGGCAGCGTTTCACCGCTGTGGAGGACCAGTATTACTGCGTGGATTGCTACAAGAACTTTGTGGCCAAGAAGTGTGCTGGATGCAAGAACCCCATCACTGGGTTTGGTAAAGGCTCCAGTGTGGTGGCCTATGAAGGACAATCCTGGCACGACTACTGCTTCCACTGCAAAAAATGCTCCGTGAATCTGGCCAACAAGCGCTTTGTTTTCCACCAGGAGCAAGTGTATTGTCCCGACTGTGCCAAAAAGCTGTAAACTGACAGGGGCTCCTGTCCTGTAAAATGGCATTTGAATCTCGTTCTTTGTGTCCTTACTTTCTGCCCTATACCATCAATAGGGGAAGAGTGGTCCTTCCCTTCTTTAAAGTTCTCCTTCCGTCTTTTCTCCCATTTTACAGTATTACTCAAATAAGGGCACACAGTGATCATATTAGCATTTAGCAAAAAGCAACCCTGCAGCAAAGTGAATTTCTGTCCGGCTGCAATTTAAAAATGAAAACTTAGGTAGATTGACTCTTCTGCATGTTTCTCATAGAGCAGAAAAGTGCTAATCATTTAGCCACTTAGTGATGTAAGCAAGAAGCATAGGAGATAAAACCCCCACTGAGATGCCTCTCATGCCTCAGCTGGGACCCACCGTGTAGACACACGACATGCAAGAGTTGCAGCGGCTGCTCCAACTCACTGCTCACCCTCTTCTGTGAGCAGGAAAAGAACCCTACTGACATGCATGGTTTAACTTCCTCATCAGAACTCTGCCCTTCCTTCTGTTCTTTTGTGCTTTCAAATAACTAACACGAACTTCCAGAAAATTAACATTTGAACTTAGCTGTAATTCTAAACTGACCTTTCCCCGTACTAACGTTTGGTTTCCCCGTGTGGCATGTTTTCTGAGCGTTCCTACTTTAAAGCATGGAACATGCAGGTGATTTGGGAAGTGTAGAAAGACCTGAGAAAACGAGCCTGTTTCAGAGGAACATCGTCACAACGAATACTTCTGGAAGCTTAACAAAACTAACCCTGCTGTCCTTTTTATTGTTTTTAATTAATATTTTTGTTTTAATTGATAGCAAAATAGTTTATGGGTTTGGAAACTTGCATGAAAATATTTTAGCCCCCTCAGATGTTCCTGCAGTGCTGAAATTCATCCTACGGAAGTAACCGCAAAACTCTAGAGGGGGAGTTGAGCAGGCGCCAGGGCTGTCATCAACATGGATATGACATTTCACAACAGTGACTAGTTGAATCCCTTGTAACGTAGTAGTTGTCTGCTCTTTGTCCATGTGTTAATGAGGACTGCAAAGTCCCTTCTGTTGTGATTCCTAGGACTTTTCCTCAAGAGGAAATCTGGATTTCCACCTACCGCTTACCTGAAATGCAGGATCACCTACTTACTGTATTCTACATTATTATATGACATAGTATAATGAGACAATATCAAAAGTAAACATGTAATGACAATACATACTAACATTCTTGTAGGAGTGGTTAGAGAAGCTGATGCCTCATTTCTACATTCTGTCATTAGCTATTATCATCTAACGTTTCAGTGTATCCTTACAGAAATAAAGCAGCATATGAATAACCTGCCTCCTGTCTTTTCATTCTGCCTGGTGGAATCGCTATAAGGTGATACTCCTAATCCAGAAACCTAAATGACTTATTTTCCTTCCAGGATATACTCACTTTAGTGCAGGCGCACAGAACATAGGAATTATAAACAAACCTGTAAAAACCAC